Incidental Mutation 'R2071:Chek2'
ID227127
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Namecheckpoint kinase 2
SynonymsRad53, CHK2
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110839979-110874145 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 110841246 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056937] [ENSMUST00000066160] [ENSMUST00000145318] [ENSMUST00000198373] [ENSMUST00000199937] [ENSMUST00000200172]
Predicted Effect probably benign
Transcript: ENSMUST00000056937
SMART Domains Protein: ENSMUSP00000062811
Gene: ENSMUSG00000043510

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DnaJ 70 135 6.53e-3 SMART
Pfam:HSCB_C 156 228 9.4e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000066160
AA Change: S12P
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521
AA Change: S12P

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144850
Predicted Effect probably benign
Transcript: ENSMUST00000145318
SMART Domains Protein: ENSMUSP00000120926
Gene: ENSMUSG00000043510

DomainStartEndE-ValueType
DnaJ 19 84 6.53e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000198373
AA Change: S12P
Predicted Effect unknown
Transcript: ENSMUST00000199937
AA Change: S12P
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521
AA Change: S12P

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200172
AA Change: S12P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200630
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110848670 missense probably damaging 1.00
IGL01830:Chek2 APN 5 110873508 missense probably benign
IGL01943:Chek2 APN 5 110841227 unclassified probably benign
IGL02319:Chek2 APN 5 110867011 missense possibly damaging 0.88
IGL03147:Chek2 UTSW 5 110848670 missense probably damaging 1.00
PIT4520001:Chek2 UTSW 5 110863329 missense probably damaging 1.00
R1484:Chek2 UTSW 5 110848687 missense probably damaging 1.00
R1486:Chek2 UTSW 5 110841227 unclassified probably benign
R1732:Chek2 UTSW 5 110872102 missense probably benign 0.26
R2041:Chek2 UTSW 5 110848664 missense probably damaging 1.00
R2873:Chek2 UTSW 5 110863336 nonsense probably null
R2935:Chek2 UTSW 5 110868020 missense probably damaging 1.00
R3899:Chek2 UTSW 5 110865613 splice site probably benign
R4662:Chek2 UTSW 5 110867042 missense probably damaging 1.00
R4748:Chek2 UTSW 5 110855839 splice site probably null
R5358:Chek2 UTSW 5 110841282 unclassified probably benign
R5582:Chek2 UTSW 5 110868035 missense probably damaging 0.96
R5594:Chek2 UTSW 5 110855834 critical splice donor site probably null
R6526:Chek2 UTSW 5 110848690 missense probably damaging 1.00
R6972:Chek2 UTSW 5 110855839 splice site probably null
R7232:Chek2 UTSW 5 110860915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACATGACTAATTTTGGGTAGAG -3'
(R):5'- AGCTCAGAGTCCCAGAACTG -3'

Sequencing Primer
(F):5'- GTTATAGGAAACCTCGAGCTGCC -3'
(R):5'- CTGGAGTGCGAGGACTGG -3'
Posted On2014-09-17