Incidental Mutation 'R2071:Pdzph1'
ID227185
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58974097 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 397 (R397G)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: R397G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: R397G

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTTCCTCACCTCTGCAG -3'
(R):5'- TGAAGAGGGAGAGTCTGCTACC -3'

Sequencing Primer
(F):5'- GCAGCCCATGTTGTCTGC -3'
(R):5'- TGCTACCTCTCCGCAGAAG -3'
Posted On2014-09-17