Incidental Mutation 'R2072:Zfp37'
List |< first << previous [record 75 of 77] next >> last >|
ID227208
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Namezinc finger protein 37
SynonymsZfp-37, Tzn
MMRRC Submission 040077-MU
Accession Numbers

Genbank: NM_009554.3; Ensembl: ENSMUST00000068822

Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62189540-62231047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62191708 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 411 (M411K)
Ref Sequence ENSEMBL: ENSMUSP00000152266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
Predicted Effect probably damaging
Transcript: ENSMUST00000068822
AA Change: M414K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: M414K

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129511
AA Change: M60K

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148664
Predicted Effect probably damaging
Transcript: ENSMUST00000220873
AA Change: M373K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000221329
AA Change: M411K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000222050
AA Change: M410K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222748
AA Change: M373K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62192311 missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62191378 missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62191885 start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62191665 nonsense probably null
R1258:Zfp37 UTSW 4 62191817 missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2262:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R2897:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62192563 missense probably benign 0.00
R3879:Zfp37 UTSW 4 62191335 nonsense probably null
R4034:Zfp37 UTSW 4 62191696 missense probably damaging 1.00
R4491:Zfp37 UTSW 4 62192128 missense probably benign 0.07
R4823:Zfp37 UTSW 4 62191503 missense probably benign 0.18
R5186:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62191765 missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62191234 missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62191213 missense possibly damaging 0.47
X0026:Zfp37 UTSW 4 62205089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCTTTCCCACATTCAACA -3'
(R):5'- TGGCAAAGCACACGGACA -3'

Sequencing Primer
(F):5'- TTCAAAGGGGCAGTCACCTGTATG -3'
(R):5'- GCCCTACAAATGTAATGAATGTGGC -3'
Posted On2014-09-17