Incidental Mutation 'R2072:Herc2'
ID227226
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase 2
SynonymsD7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location56050196-56231800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56226964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 4516 (N4516S)
Ref Sequence ENSEMBL: ENSMUSP00000131573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
Predicted Effect probably damaging
Transcript: ENSMUST00000076226
AA Change: N4516S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: N4516S

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164095
AA Change: N4516S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: N4516S

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205303
AA Change: N4480S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000205678
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 56124299 missense probably damaging 1.00
IGL00529:Herc2 APN 7 56157753 missense probably benign
IGL00548:Herc2 APN 7 56206565 missense probably benign 0.20
IGL00970:Herc2 APN 7 56181064 splice site probably benign
IGL01141:Herc2 APN 7 56212841 missense possibly damaging 0.47
IGL01147:Herc2 APN 7 56156949 missense probably benign 0.43
IGL01150:Herc2 APN 7 56181133 missense probably damaging 1.00
IGL01519:Herc2 APN 7 56103950 missense probably damaging 1.00
IGL01576:Herc2 APN 7 56226661 critical splice donor site probably null
IGL01626:Herc2 APN 7 56085142 missense probably benign 0.02
IGL01658:Herc2 APN 7 56159452 missense probably damaging 1.00
IGL01707:Herc2 APN 7 56165187 missense probably damaging 1.00
IGL01727:Herc2 APN 7 56137806 missense probably damaging 1.00
IGL01935:Herc2 APN 7 56153793 missense probably benign
IGL01969:Herc2 APN 7 56185831 splice site probably benign
IGL02074:Herc2 APN 7 56087444 splice site probably benign
IGL02261:Herc2 APN 7 56206744 missense probably damaging 0.99
IGL02339:Herc2 APN 7 56121722 missense probably benign 0.01
IGL02353:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02360:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02409:Herc2 APN 7 56220469 splice site probably null
IGL02528:Herc2 APN 7 56108893 splice site probably benign
IGL02571:Herc2 APN 7 56153386 missense probably damaging 1.00
IGL02578:Herc2 APN 7 56106535 splice site probably null
IGL02661:Herc2 APN 7 56113073 missense probably damaging 1.00
IGL02664:Herc2 APN 7 56135678 nonsense probably null
IGL02675:Herc2 APN 7 56164101 missense probably damaging 0.99
IGL02689:Herc2 APN 7 56165283 splice site probably benign
IGL02710:Herc2 APN 7 56137814 missense possibly damaging 0.95
IGL02750:Herc2 APN 7 56204379 splice site probably benign
IGL02754:Herc2 APN 7 56097498 missense probably damaging 1.00
IGL03029:Herc2 APN 7 56168967 missense probably damaging 1.00
IGL03039:Herc2 APN 7 56169021 splice site probably benign
IGL03082:Herc2 APN 7 56185923 missense probably benign 0.19
IGL03090:Herc2 APN 7 56204473 missense probably damaging 0.96
IGL03154:Herc2 APN 7 56202159 missense probably damaging 1.00
IGL03165:Herc2 APN 7 56191912 missense probably damaging 1.00
IGL03201:Herc2 APN 7 56219768 missense probably damaging 1.00
IGL03234:Herc2 APN 7 56103862 missense probably damaging 1.00
IGL03293:Herc2 APN 7 56155130 missense probably benign 0.43
IGL03331:Herc2 APN 7 56135267 splice site probably benign
IGL03340:Herc2 APN 7 56090920 missense possibly damaging 0.51
IGL03409:Herc2 APN 7 56228569 missense probably damaging 1.00
I0000:Herc2 UTSW 7 56136729 splice site probably benign
PIT1430001:Herc2 UTSW 7 56226954 missense probably damaging 1.00
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0058:Herc2 UTSW 7 56170483 missense possibly damaging 0.93
R0114:Herc2 UTSW 7 56153774 splice site probably benign
R0117:Herc2 UTSW 7 56213611 splice site probably benign
R0141:Herc2 UTSW 7 56121561 missense probably benign 0.17
R0266:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0401:Herc2 UTSW 7 56157732 missense probably damaging 0.99
R0403:Herc2 UTSW 7 56159417 missense probably damaging 1.00
R0437:Herc2 UTSW 7 56219815 nonsense probably null
R0491:Herc2 UTSW 7 56122366 missense possibly damaging 0.54
R0499:Herc2 UTSW 7 56184369 nonsense probably null
R0580:Herc2 UTSW 7 56138791 missense probably damaging 1.00
R0650:Herc2 UTSW 7 56113210 missense probably damaging 1.00
R0744:Herc2 UTSW 7 56206036 splice site probably benign
R0798:Herc2 UTSW 7 56135683 critical splice donor site probably null
R0842:Herc2 UTSW 7 56121705 missense probably benign
R0849:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0850:Herc2 UTSW 7 56204483 missense probably benign 0.09
R0926:Herc2 UTSW 7 56132548 missense possibly damaging 0.67
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1292:Herc2 UTSW 7 56197203 missense probably benign 0.05
R1370:Herc2 UTSW 7 56168873 missense probably benign 0.01
R1443:Herc2 UTSW 7 56204733 missense possibly damaging 0.69
R1445:Herc2 UTSW 7 56168996 missense probably damaging 1.00
R1541:Herc2 UTSW 7 56135657 missense probably damaging 1.00
R1550:Herc2 UTSW 7 56135658 missense probably damaging 1.00
R1551:Herc2 UTSW 7 56146669 missense probably benign 0.01
R1633:Herc2 UTSW 7 56229369 intron probably null
R1635:Herc2 UTSW 7 56136667 missense probably benign 0.00
R1659:Herc2 UTSW 7 56135105 missense probably benign 0.00
R1682:Herc2 UTSW 7 56088400 missense possibly damaging 0.87
R1697:Herc2 UTSW 7 56153905 missense probably benign 0.43
R1748:Herc2 UTSW 7 56148823 critical splice donor site probably null
R1802:Herc2 UTSW 7 56184332 missense probably damaging 1.00
R1835:Herc2 UTSW 7 56206765 nonsense probably null
R1836:Herc2 UTSW 7 56155105 nonsense probably null
R1872:Herc2 UTSW 7 56157509 missense probably benign 0.18
R1889:Herc2 UTSW 7 56189813 missense possibly damaging 0.60
R1906:Herc2 UTSW 7 56114864 missense probably benign 0.01
R2004:Herc2 UTSW 7 56137859 missense probably damaging 1.00
R2030:Herc2 UTSW 7 56184373 missense probably damaging 0.99
R2037:Herc2 UTSW 7 56205961 missense probably damaging 1.00
R2059:Herc2 UTSW 7 56163897 missense probably damaging 1.00
R2068:Herc2 UTSW 7 56132497 missense probably damaging 1.00
R2085:Herc2 UTSW 7 56212965 missense possibly damaging 0.94
R2115:Herc2 UTSW 7 56185828 splice site probably benign
R2160:Herc2 UTSW 7 56212922 missense probably benign 0.00
R2173:Herc2 UTSW 7 56185951 missense probably benign 0.27
R2221:Herc2 UTSW 7 56169018 critical splice donor site probably null
R2280:Herc2 UTSW 7 56137271 missense possibly damaging 0.79
R3078:Herc2 UTSW 7 56137243 missense probably benign
R3104:Herc2 UTSW 7 56135355 missense probably benign 0.23
R3177:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3277:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3766:Herc2 UTSW 7 56163824 missense probably damaging 1.00
R3770:Herc2 UTSW 7 56165007 missense probably benign
R3807:Herc2 UTSW 7 56207809 missense probably damaging 1.00
R3912:Herc2 UTSW 7 56098437 missense probably damaging 0.98
R4004:Herc2 UTSW 7 56106465 missense possibly damaging 0.53
R4039:Herc2 UTSW 7 56156411 missense probably damaging 0.98
R4190:Herc2 UTSW 7 56122448 missense probably benign 0.03
R4225:Herc2 UTSW 7 56164987 missense probably damaging 1.00
R4334:Herc2 UTSW 7 56226654 missense probably damaging 1.00
R4405:Herc2 UTSW 7 56170477 missense probably damaging 1.00
R4448:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4450:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4565:Herc2 UTSW 7 56153838 missense possibly damaging 0.71
R4667:Herc2 UTSW 7 56131253 missense probably damaging 1.00
R4747:Herc2 UTSW 7 56106393 missense possibly damaging 0.80
R4762:Herc2 UTSW 7 56170640 missense probably benign 0.19
R4829:Herc2 UTSW 7 56106492 missense probably benign 0.39
R4832:Herc2 UTSW 7 56098417 nonsense probably null
R4895:Herc2 UTSW 7 56222986 missense probably damaging 1.00
R4904:Herc2 UTSW 7 56157486 missense probably damaging 0.99
R4908:Herc2 UTSW 7 56177912 missense probably benign 0.01
R4911:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4921:Herc2 UTSW 7 56229690 missense probably benign 0.04
R4939:Herc2 UTSW 7 56206736 missense probably damaging 1.00
R5155:Herc2 UTSW 7 56227826 missense possibly damaging 0.85
R5184:Herc2 UTSW 7 56122351 missense probably damaging 1.00
R5269:Herc2 UTSW 7 56168870 nonsense probably null
R5306:Herc2 UTSW 7 56184961 missense probably damaging 1.00
R5314:Herc2 UTSW 7 56219786 missense probably damaging 0.99
R5369:Herc2 UTSW 7 56182700 missense probably damaging 1.00
R5418:Herc2 UTSW 7 56137565 missense probably damaging 1.00
R5420:Herc2 UTSW 7 56203830 missense probably damaging 0.96
R5463:Herc2 UTSW 7 56194262 missense probably damaging 1.00
R5510:Herc2 UTSW 7 56206771 missense probably damaging 1.00
R5634:Herc2 UTSW 7 56206783 missense probably damaging 1.00
R5638:Herc2 UTSW 7 56204416 missense probably benign 0.01
R5690:Herc2 UTSW 7 56157705 missense probably benign
R5762:Herc2 UTSW 7 56197190 missense possibly damaging 0.68
R5807:Herc2 UTSW 7 56230919 missense probably damaging 0.99
R5878:Herc2 UTSW 7 56124248 missense probably benign
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6083:Herc2 UTSW 7 56228505 missense probably benign 0.00
R6192:Herc2 UTSW 7 56207762 missense probably damaging 1.00
R6193:Herc2 UTSW 7 56156901 missense probably damaging 0.98
R6261:Herc2 UTSW 7 56197072 nonsense probably null
R6267:Herc2 UTSW 7 56153166 nonsense probably null
R6267:Herc2 UTSW 7 56204718 missense possibly damaging 0.51
R6298:Herc2 UTSW 7 56191265 missense probably benign
R6299:Herc2 UTSW 7 56135055 missense possibly damaging 0.86
R6326:Herc2 UTSW 7 56222934 missense probably damaging 0.98
R6347:Herc2 UTSW 7 56194403 critical splice donor site probably null
R6394:Herc2 UTSW 7 56215981 missense probably damaging 1.00
R6500:Herc2 UTSW 7 56146645 nonsense probably null
R6526:Herc2 UTSW 7 56157330 missense probably damaging 0.99
R6591:Herc2 UTSW 7 56207690 critical splice acceptor site probably null
R6619:Herc2 UTSW 7 56068092 nonsense probably null
R6719:Herc2 UTSW 7 56212826 missense probably damaging 1.00
R6750:Herc2 UTSW 7 56097447 missense probably damaging 1.00
R6807:Herc2 UTSW 7 56164922 missense probably damaging 1.00
R6811:Herc2 UTSW 7 56113433 nonsense probably null
R6837:Herc2 UTSW 7 56189841 missense possibly damaging 0.89
R6838:Herc2 UTSW 7 56108778 missense probably damaging 1.00
R6902:Herc2 UTSW 7 56135486 missense probably benign 0.37
R6983:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56132480 missense probably damaging 1.00
R6986:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6987:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
X0011:Herc2 UTSW 7 56131292 missense probably benign
X0023:Herc2 UTSW 7 56090918 missense possibly damaging 0.73
X0057:Herc2 UTSW 7 56229690 missense probably benign 0.04
X0064:Herc2 UTSW 7 56191211 missense probably benign 0.01
X0064:Herc2 UTSW 7 56191258 missense probably benign
Z1088:Herc2 UTSW 7 56087341 missense probably benign 0.00
Z1088:Herc2 UTSW 7 56131292 missense probably benign
Z1088:Herc2 UTSW 7 56215381 missense possibly damaging 0.86
Z1088:Herc2 UTSW 7 56215432 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56226589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAGTAGCCATCCTCCTG -3'
(R):5'- TCATTGCCAATGTCTCAAAAGC -3'

Sequencing Primer
(F):5'- GTAGCCATCCTCCTGGTGCTG -3'
(R):5'- TTGCCAATGTCTCAAAAGCTAAAC -3'
Posted On2014-09-17