Incidental Mutation 'R2072:Upf3a'
ID227232
Institutional Source Beutler Lab
Gene Symbol Upf3a
Ensembl Gene ENSMUSG00000038398
Gene NameUPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms2600001C03Rik, RENT3A, 4930546M19Rik, UPF3
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R2072 (G1)
Quality Score107
Status Not validated
Chromosome8
Chromosomal Location13785615-13799193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13785850 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 56 (K56R)
Ref Sequence ENSEMBL: ENSMUSP00000037354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767] [ENSMUST00000043962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043767
AA Change: K56R

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398
AA Change: K56R

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043962
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene product protects against mRNA transcript degradation. Homozygous constitutive KO is embryonic lethal. Homozygous conditional KO in testes leads to reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G260E probably damaging Het
Btbd17 A T 11: 114,791,952 F311L probably null Het
Cacna1s G A 1: 136,079,504 V420I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L320* probably null Het
Smg1 T C 7: 118,163,166 I2067V probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q176L unknown Het
Other mutations in Upf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Upf3a APN 8 13786221 missense probably damaging 0.98
IGL01678:Upf3a APN 8 13791930 missense probably benign 0.21
IGL02072:Upf3a APN 8 13798368 missense probably damaging 0.99
R0309:Upf3a UTSW 8 13795500 splice site probably null
R0564:Upf3a UTSW 8 13795656 missense probably benign 0.42
R0571:Upf3a UTSW 8 13792184 missense probably damaging 0.98
R0826:Upf3a UTSW 8 13798338 missense possibly damaging 0.65
R1387:Upf3a UTSW 8 13792118 missense probably damaging 1.00
R1913:Upf3a UTSW 8 13792108 missense probably damaging 1.00
R2520:Upf3a UTSW 8 13796443 intron probably null
R3845:Upf3a UTSW 8 13798238 missense probably benign 0.16
R4239:Upf3a UTSW 8 13796591 missense probably benign 0.28
R4424:Upf3a UTSW 8 13796573 missense probably benign 0.09
R5522:Upf3a UTSW 8 13795497 critical splice donor site probably null
R6321:Upf3a UTSW 8 13787466 missense possibly damaging 0.53
R6922:Upf3a UTSW 8 13791911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCGAATTCCAAGGGAGG -3'
(R):5'- ATCCTAGTCCAGACTGCTCG -3'

Sequencing Primer
(F):5'- ATTCCAAGGGAGGGGCTGC -3'
(R):5'- TAGTCCAGACTGCTCGCAACAG -3'
Posted On2014-09-17