Incidental Mutation 'R2072:Cnot1'
ID227238
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95739833 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1592 (T1592K)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: T1587K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: T1587K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: T1592K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: T1592K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: T1585K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212712
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: T1592K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G260E probably damaging Het
Btbd17 A T 11: 114,791,952 F311L probably null Het
Cacna1s G A 1: 136,079,504 V420I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L320* probably null Het
Smg1 T C 7: 118,163,166 I2067V probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q176L unknown Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 unclassified probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 unclassified probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 unclassified probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Xiao UTSW 8 95730420 missense
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 missense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTGACATGCTGATCTAAC -3'
(R):5'- TAGCTGGGCATTTTAGCAGG -3'

Sequencing Primer
(F):5'- CAAAGATCAGTTGTAACCAATGGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'
Posted On2014-09-17