Incidental Mutation 'R2072:Kif5a'
ID227250
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Namekinesin family member 5A
SynonymsKhc, Kns, Kif5, D10Bwg0738e
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127225696-127263363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127245369 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 232 (D232G)
Ref Sequence ENSEMBL: ENSMUSP00000096775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895]
Predicted Effect probably damaging
Transcript: ENSMUST00000099172
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: D232G

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217895
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T406A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G260E probably damaging Het
Btbd17 A T 11: 114,791,952 F311L probably damaging Het
Cacna1s G A 1: 136,079,504 V420I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably damaging Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E probably benign Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L320* probably null Het
Smg1 T C 7: 118,163,166 I1991V probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q176L unknown Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 splice site probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATATTTGCTTATTACTGGGGAGGGC -3'
(R):5'- AACCGTCACGTAGCTGTCAC -3'

Sequencing Primer
(F):5'- ACTGGGGAGGGCTTGTAATATTATC -3'
(R):5'- TCACGTAGCTGTCACCAGTAAGTG -3'
Posted OnSep 17, 2014