Incidental Mutation 'R2072:Paip1'
List |< first << previous [record 44 of 77] next >> last >|
ID227257
Institutional Source Beutler Lab
Gene Symbol Paip1
Ensembl Gene ENSMUSG00000025451
Gene Namepolyadenylate binding protein-interacting protein 1
Synonyms
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119428601-119458218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119430262 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000117256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026520
AA Change: V44A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451
AA Change: V44A

DomainStartEndE-ValueType
Pfam:PAM2 44 61 8.9e-8 PFAM
MIF4G 80 297 2.62e-46 SMART
low complexity region 373 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109203
AA Change: V11A

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451
AA Change: V11A

DomainStartEndE-ValueType
Pfam:PAM2 11 28 3.7e-7 PFAM
MIF4G 47 264 2.62e-46 SMART
low complexity region 340 352 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126957
AA Change: V128A

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451
AA Change: V128A

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 3.3e-7 PFAM
MIF4G 164 381 2.62e-46 SMART
low complexity region 457 469 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132304
AA Change: V132A
SMART Domains Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451
AA Change: V132A

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 6.8e-5 PFAM
Pfam:MIF4G 164 267 1.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173627
AA Change: V44A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451
AA Change: V44A

DomainStartEndE-ValueType
Pfam:PAM2 44 61 3.6e-7 PFAM
MIF4G 80 297 2.62e-46 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174691
AA Change: V35A
SMART Domains Protein: ENSMUSP00000134502
Gene: ENSMUSG00000025451
AA Change: V35A

DomainStartEndE-ValueType
Pfam:PAM2 36 53 2.4e-7 PFAM
Pfam:MIF4G 72 207 1.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Paip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Paip1 APN 13 119438071 missense probably damaging 1.00
IGL02873:Paip1 APN 13 119445812 missense possibly damaging 0.95
R0517:Paip1 UTSW 13 119447790 missense probably damaging 1.00
R0791:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R0792:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R1419:Paip1 UTSW 13 119457017 missense probably damaging 0.99
R1572:Paip1 UTSW 13 119451784 unclassified probably benign
R1935:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R1936:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R3827:Paip1 UTSW 13 119430232 start codon destroyed probably null 0.47
R4082:Paip1 UTSW 13 119457004 missense probably damaging 1.00
R4092:Paip1 UTSW 13 119449913 missense probably benign 0.02
R4854:Paip1 UTSW 13 119449889 splice site probably benign
R5012:Paip1 UTSW 13 119447802 missense probably benign
R5103:Paip1 UTSW 13 119437979 missense possibly damaging 0.95
R5425:Paip1 UTSW 13 119430166 missense possibly damaging 0.60
R5592:Paip1 UTSW 13 119450798 missense probably damaging 1.00
R5851:Paip1 UTSW 13 119440765 missense possibly damaging 0.94
R5929:Paip1 UTSW 13 119445790 missense probably damaging 1.00
R5976:Paip1 UTSW 13 119456997 missense probably damaging 1.00
R6021:Paip1 UTSW 13 119457135 frame shift probably null
R6326:Paip1 UTSW 13 119430217 missense probably benign 0.00
R6964:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTTCTCAGACGGTTTCTAAATCTG -3'
(R):5'- TAGTACTGAAAGCAGCCAGC -3'

Sequencing Primer
(F):5'- GGAATGAATACATCTAGCACTGTTTG -3'
(R):5'- CACAAGACTTGTAGGAGGTTT -3'
Posted On2014-09-17