Incidental Mutation 'R2072:Stk3'
ID227265
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Nameserine/threonine kinase 3
Synonymsmess1, MST, Mst2
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2072 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location34875496-35178921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34959049 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 256 (M256V)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
Predicted Effect probably benign
Transcript: ENSMUST00000018476
AA Change: M326V

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: M326V

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067033
AA Change: M256V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: M256V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128425
Predicted Effect probably benign
Transcript: ENSMUST00000226555
AA Change: M324V

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G260E probably damaging Het
Btbd17 A T 11: 114,791,952 F311L probably null Het
Cacna1s G A 1: 136,079,504 V420I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L320* probably null Het
Smg1 T C 7: 118,163,166 I2067V probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q176L unknown Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 unclassified probably benign
IGL03309:Stk3 APN 15 35099551 unclassified probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAGAGAAAGGGCTCCATAC -3'
(R):5'- TCAGCTATCTTCAAGAGGTCTTTG -3'

Sequencing Primer
(F):5'- CAGAGAGAAAGGGCTCCATACTTTTC -3'
(R):5'- ACTTACCCAGAATTCTAGTTGCAAGG -3'
Posted On2014-09-17