Incidental Mutation 'R2072:Dlgap1'
List |< first << previous [record 19 of 77] next >> last >|
ID227276
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2072 (G1)
Quality Score174
Status Not validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70662770 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 524 (R524C)
Ref Sequence ENSEMBL: ENSMUSP00000116072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060072
AA Change: R524C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: R524C

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097288
AA Change: R216C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: R216C

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126801
Predicted Effect probably damaging
Transcript: ENSMUST00000133717
AA Change: R226C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279
AA Change: R226C

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133983
AA Change: R524C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: R524C

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135938
AA Change: R524C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: R524C

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140728
AA Change: R224C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279
AA Change: R224C

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146730
AA Change: R524C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: R524C

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148486
AA Change: R224C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279
AA Change: R224C

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150798
Predicted Effect possibly damaging
Transcript: ENSMUST00000155016
AA Change: R524C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: R524C

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 70761080 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 70718227 critical splice donor site probably null
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 70815393 intron probably benign
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70593330 missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTTCGAATCCGTGTGCGAG -3'
(R):5'- CCTGTGGATTCTCACATGGTGG -3'

Sequencing Primer
(F):5'- CGAGTCTGTGTTCAGCGAGC -3'
(R):5'- ATTCTCACATGGTGGTGGAG -3'
Posted On2014-09-17