Incidental Mutation 'R2072:Dmd'
ID227283
Institutional Source Beutler Lab
Gene Symbol Dmd
Ensembl Gene ENSMUSG00000045103
Gene Namedystrophin, muscular dystrophy
SynonymsDp71, mdx, X-linked muscular dystrophy, Dp427, Duchenne muscular dystrophy, pke, dys
MMRRC Submission 040077-MU
Accession Numbers
Stock #R2072 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location82948870-85206141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 84312483 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 2257 (A2257P)
Ref Sequence ENSEMBL: ENSMUSP00000109633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114000]
Predicted Effect probably benign
Transcript: ENSMUST00000114000
AA Change: A2257P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109633
Gene: ENSMUSG00000045103
AA Change: A2257P

DomainStartEndE-ValueType
CH 17 117 5.94e-27 SMART
CH 136 235 3.83e-21 SMART
SPEC 344 448 7.39e-17 SMART
SPEC 453 557 6.49e-13 SMART
SPEC 564 668 9.73e-2 SMART
low complexity region 672 695 N/A INTRINSIC
SPEC 724 829 9.18e-13 SMART
SPEC 835 935 2.28e-1 SMART
SPEC 944 1046 9.34e-2 SMART
SPEC 1053 1155 7.99e-13 SMART
SPEC 1162 1264 7.52e-9 SMART
SPEC 1271 1368 5.53e-7 SMART
SPEC 1470 1569 7.29e-7 SMART
SPEC 1576 1677 8.29e-1 SMART
SPEC 1684 1781 1.82e-1 SMART
SPEC 1786 1875 3.48e0 SMART
SPEC 1882 1972 6.69e-2 SMART
SPEC 2000 2102 1.45e0 SMART
SPEC 2109 2209 6.15e-14 SMART
SPEC 2216 2317 8.9e-11 SMART
low complexity region 2325 2337 N/A INTRINSIC
low complexity region 2432 2444 N/A INTRINSIC
SPEC 2466 2569 1.65e-14 SMART
SPEC 2576 2678 1.2e-7 SMART
SPEC 2685 2794 9.84e-13 SMART
SPEC 2801 2923 8.38e-7 SMART
SPEC 2930 3032 1.21e-12 SMART
WW 3049 3081 1.36e-10 SMART
Pfam:EF-hand_2 3082 3200 1.7e-42 PFAM
Pfam:EF-hand_3 3204 3295 6.6e-41 PFAM
ZnF_ZZ 3300 3345 7.39e-18 SMART
coiled coil region 3488 3598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Hemizygous males and homozygous mutant females show progressive muscle atrophy, increased K+ and Ca+ in muscle with age, increased blood pyruvate kinase and other symptoms of Duchenne and Becker muscular dystrophy. Alleles vary in severity and may include cardiovascular and digestive system defects.
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T406A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G260E probably damaging Het
Btbd17 A T 11: 114,791,952 F311L probably damaging Het
Cacna1s G A 1: 136,079,504 V420I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1587K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E probably benign Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L320* probably null Het
Smg1 T C 7: 118,163,166 I1991V probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M414K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q176L unknown Het
Other mutations in Dmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Dmd APN X 83908372 unclassified probably null
IGL00823:Dmd APN X 84425813 unclassified probably null
IGL01160:Dmd APN X 83924961 unclassified probably damaging 1.00
IGL01285:Dmd APN X 85109984 unclassified probably null
IGL01294:Dmd APN X 84431998 unclassified probably null
IGL02426:Dmd APN X 84848736 unclassified probably damaging 1.00
IGL02610:Dmd APN X 83664156 unclassified probably damaging 1.00
IGL02887:Dmd APN X 83878504 unclassified probably benign 0.44
IGL03268:Dmd APN X 83806208 unclassified probably damaging 0.98
IGL03301:Dmd APN X 83908514 unclassified probably damaging 1.00
JAX1:Dmd UTSW X 83830517 missense probably damaging 1.00
JAX1:Dmd UTSW X 84312483 missense probably benign 0.33
R0480:Dmd UTSW X 84425738 missense probably benign 0.00
R0714:Dmd UTSW X 84309897 missense probably benign 0.00
R1296:Dmd UTSW X 83878520 missense probably damaging 1.00
R1448:Dmd UTSW X 84848700 missense probably damaging 0.97
R1678:Dmd UTSW X 84974762 missense probably benign 0.43
R1714:Dmd UTSW X 83964750 missense probably benign 0.17
R1951:Dmd UTSW X 83830517 missense probably damaging 1.00
R1952:Dmd UTSW X 83830517 missense probably damaging 1.00
R1953:Dmd UTSW X 83830517 missense probably damaging 1.00
R1955:Dmd UTSW X 83878557 missense probably benign 0.10
R2073:Dmd UTSW X 84312483 missense probably benign 0.33
R2074:Dmd UTSW X 84312483 missense probably benign 0.33
R2075:Dmd UTSW X 84312483 missense probably benign 0.33
R2118:Dmd UTSW X 84312483 missense probably benign 0.33
R2119:Dmd UTSW X 84312483 missense probably benign 0.33
R2120:Dmd UTSW X 84312483 missense probably benign 0.33
R2122:Dmd UTSW X 84312483 missense probably benign 0.33
R4398:Dmd UTSW X 83722018 missense probably benign 0.01
X0025:Dmd UTSW X 84647194 missense probably benign
Z1088:Dmd UTSW X 83878495 missense possibly damaging 0.67
Z1088:Dmd UTSW X 84575760 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCAGCCCATCAGCTCTGTG -3'
(R):5'- AAGAATAATCCACCCTTCTGCTTC -3'

Sequencing Primer
(F):5'- GCTCTGTGCTCTGTGGAAG -3'
(R):5'- GTTGCAACACTTAGCACATGTGAC -3'
Posted OnSep 17, 2014