Incidental Mutation 'R2072:Nhs'
List |< first << previous [record 37 of 77] next >> last >|
ID227285
Institutional Source Beutler Lab
Gene Symbol Nhs
Ensembl Gene ENSMUSG00000059493
Gene NameNHS actin remodeling regulator
SynonymsLOC195727, LOC245686
MMRRC Submission 040077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2072 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location161833296-162159730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 161842721 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 544 (H544L)
Ref Sequence ENSEMBL: ENSMUSP00000080280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081569] [ENSMUST00000087085]
Predicted Effect probably damaging
Transcript: ENSMUST00000081569
AA Change: H544L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080280
Gene: ENSMUSG00000059493
AA Change: H544L

DomainStartEndE-ValueType
low complexity region 34 77 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
Pfam:NHS 414 1054 2.5e-226 PFAM
low complexity region 1451 1468 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087085
AA Change: H565L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084319
Gene: ENSMUSG00000059493
AA Change: H565L

DomainStartEndE-ValueType
low complexity region 34 77 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 389 397 N/A INTRINSIC
Pfam:NHS 436 1075 1.9e-217 PFAM
low complexity region 1472 1489 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Heterozygous females exhibit variable and patchy lens opacity. Homozygous females and hemizygous males exhibit complete lens opacity associated with progressive degeneration of primary fibers beginning around embryonic day 15. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Grik5 A T 7: 25,015,313 M752K possibly damaging Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G possibly damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Nhs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Nhs APN X 161837230 missense probably damaging 1.00
IGL00963:Nhs APN X 161847049 missense probably damaging 1.00
IGL01330:Nhs APN X 161841453 missense probably damaging 1.00
IGL02585:Nhs APN X 161841764 missense probably damaging 1.00
IGL02645:Nhs APN X 162159058 missense probably benign 0.00
IGL03223:Nhs APN X 161841906 missense probably damaging 0.99
R0511:Nhs UTSW X 161837359 missense probably damaging 1.00
R0512:Nhs UTSW X 161837359 missense probably damaging 1.00
R0730:Nhs UTSW X 161837300 missense possibly damaging 0.76
R2073:Nhs UTSW X 161842721 missense probably damaging 1.00
X0024:Nhs UTSW X 161840222 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGTTACCACTGGATGACTGGTG -3'
(R):5'- CGTACAAGATCTCGGAGCCTTC -3'

Sequencing Primer
(F):5'- CCACTGGATGACTGGTGGTCTTC -3'
(R):5'- ATCTCGGAGCCTTCCTCGG -3'
Posted On2014-09-17