Incidental Mutation 'R2073:1110017D15Rik'
ID227312
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41507519 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000095126] [ENSMUST00000149596]
Predicted Effect probably null
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124019
Predicted Effect probably null
Transcript: ENSMUST00000125303
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125303
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138217
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GACAGCGAGTTCAGCATGTTC -3'
(R):5'- ATTCTGGGAGGGCATTTCC -3'

Sequencing Primer
(F):5'- GCGAGTTCAGCATGTTCACCAC -3'
(R):5'- TGGAGTCAGTTCGAGGAA -3'
Posted On2014-09-17