Incidental Mutation 'R0149:Ascc3'
ID22733
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 038433-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0149 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50607993 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 55 (N55I)
Ref Sequence ENSEMBL: ENSMUSP00000151273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606] [ENSMUST00000219226] [ENSMUST00000220355]
Predicted Effect probably benign
Transcript: ENSMUST00000035606
AA Change: N55I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: N55I

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220178
Predicted Effect probably benign
Transcript: ENSMUST00000220355
AA Change: N55I

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (84/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A C 8: 12,280,000 S152R unknown Het
Acsbg2 A G 17: 56,853,924 probably benign Het
Adam6a G T 12: 113,545,749 V581F probably damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Aldh1l1 A G 6: 90,589,414 K656E possibly damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Clk1 T A 1: 58,414,601 N305Y probably damaging Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Cyp2d26 A G 15: 82,792,767 L152P probably damaging Het
Dmtf1 A G 5: 9,132,571 S188P probably damaging Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dscaml1 T G 9: 45,742,680 Y1418* probably null Het
Efemp2 A T 19: 5,477,960 H107L probably damaging Het
Eng T C 2: 32,672,385 probably null Het
Erc1 A T 6: 119,824,830 S75R probably damaging Het
Fgl2 A T 5: 21,375,785 D375V probably damaging Het
Fpr-rs6 T C 17: 20,182,213 I295M probably benign Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm6614 T C 6: 141,992,477 T239A probably benign Het
Gmcl1 A T 6: 86,732,909 probably null Het
Has1 T C 17: 17,850,171 T163A probably damaging Het
Hmcn1 A T 1: 150,677,324 N2538K probably benign Het
Itga2 A G 13: 114,836,579 probably benign Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kcnk4 T C 19: 6,926,194 E329G probably benign Het
Kcnt1 T C 2: 25,898,264 probably benign Het
Klkb1 A G 8: 45,276,063 C375R probably damaging Het
Loxl2 C A 14: 69,693,078 H764N probably benign Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Magi1 A T 6: 93,747,245 I263N probably damaging Het
Map4 C T 9: 110,067,624 P641L probably damaging Het
Mars A T 10: 127,300,034 N558K probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mgat5b A G 11: 116,985,139 probably benign Het
Mki67 A T 7: 135,698,424 V1627D probably benign Het
Mtnr1a A T 8: 45,069,315 I36F probably benign Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Ngf T A 3: 102,520,446 H174Q probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Olfr935 T A 9: 38,994,584 M284L probably benign Het
Osmr A G 15: 6,841,951 probably null Het
P4ha1 A G 10: 59,348,399 T228A probably damaging Het
Pip5kl1 T C 2: 32,578,954 V195A possibly damaging Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plxna1 T C 6: 89,320,613 E1863G probably null Het
Prdm10 T G 9: 31,316,159 probably benign Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Rgs1 T C 1: 144,249,087 probably benign Het
Rgsl1 A G 1: 153,793,764 F292S probably damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Rsph10b T A 5: 143,938,909 probably benign Het
Rwdd4a A G 8: 47,544,220 D158G probably null Het
Sdk1 T C 5: 141,857,054 probably benign Het
Serpina3n A C 12: 104,411,376 K296T probably benign Het
Snw1 A G 12: 87,461,917 V124A possibly damaging Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmc6 G A 11: 117,769,448 L655F probably damaging Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Tsc1 T C 2: 28,670,901 I257T probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Unc80 T A 1: 66,521,601 N829K possibly damaging Het
Vmn1r235 A C 17: 21,261,995 D194A probably damaging Het
Vmn2r100 A T 17: 19,521,247 probably null Het
Ylpm1 G T 12: 85,028,838 R321L probably damaging Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCAAAGCCAGGGATCTGACATGAAA -3'
(R):5'- CCTCCTGCTGAGAAACTCAACTCTCAA -3'

Sequencing Primer
(F):5'- CCAGGGTCATATTCTGAAAACAG -3'
(R):5'- GCTGAGAAACTCAACTCTCAATGTTC -3'
Posted On2013-04-16