Incidental Mutation 'R2073:Zfp715'
ID227332
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43311120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 16 (T16S)
Ref Sequence ENSEMBL: ENSMUSP00000114600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
AA Change: T16S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640
AA Change: T16S

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000048015
AA Change: T16S
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: T16S

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107986
AA Change: T16S
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: T16S

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000135130
AA Change: T16S
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640
AA Change: T16S

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139061
AA Change: T16S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640
AA Change: T16S

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000145622
AA Change: T16S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GATGGTCTCAGAAGTCTGCAG -3'
(R):5'- AACAAGAGCAGGGCTTTTATGTATC -3'

Sequencing Primer
(F):5'- AGAAGTCTGCAGCTTCCTG -3'
(R):5'- GAGCAGGGCTTTTATGTATCCTCTAC -3'
Posted On2014-09-17