Incidental Mutation 'R2073:Setd6'
ID227337
Institutional Source Beutler Lab
Gene Symbol Setd6
Ensembl Gene ENSMUSG00000031671
Gene NameSET domain containing 6
Synonyms0610039J04Rik
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95715881-95719010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95716788 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 60 (V60M)
Ref Sequence ENSEMBL: ENSMUSP00000148466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000041318] [ENSMUST00000068452] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000098473] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably damaging
Transcript: ENSMUST00000034096
AA Change: V220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671
AA Change: V220M

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SET 62 293 1.84e0 SMART
Pfam:Rubis-subs-bind 330 465 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041318
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068452
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073139
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098473
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126888
Predicted Effect probably damaging
Transcript: ENSMUST00000141900
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000148727
AA Change: V57M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161314
Predicted Effect probably benign
Transcript: ENSMUST00000162578
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212302
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that adds a methyl group to the histone H2AZ, which is involved in nuclear receptor-dependent transcription. The protein also interacts with several endogenous proteins which are involved in nuclear hormone receptor signaling. A related pseudogene is located on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Setd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Setd6 APN 8 95716692 missense probably damaging 1.00
IGL02984:Setd6 UTSW 8 95716275 splice site probably null
R0021:Setd6 UTSW 8 95716665 missense probably damaging 1.00
R0140:Setd6 UTSW 8 95716109 missense probably damaging 1.00
R1487:Setd6 UTSW 8 95717928 missense probably damaging 1.00
R4672:Setd6 UTSW 8 95718012 missense probably null 0.11
R4817:Setd6 UTSW 8 95717055 unclassified probably benign
R5960:Setd6 UTSW 8 95716199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCTGTTGCAGTTTCTTTG -3'
(R):5'- ATCAAGGGTGAGTTGGGCTC -3'

Sequencing Primer
(F):5'- GCACCTGCTGCATGAGAAG -3'
(R):5'- GTGAGTTGGGCTCCTTTTCATCATC -3'
Posted On2014-09-17