Incidental Mutation 'R2074:Cenpf'
ID227396
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189656901 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1578 (K1578R)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165962
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: K1578R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: K1578R

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGAAGTCGTGCTACCTC -3'
(R):5'- TAGAAGGGAACGCTTCAGC -3'

Sequencing Primer
(F):5'- TGCTACCTCAAGTTCAAGGG -3'
(R):5'- GGGAACGCTTCAGCAAATTCTTG -3'
Posted On2014-09-17