Incidental Mutation 'R2074:Tex10'
ID227408
Institutional Source Beutler Lab
Gene Symbol Tex10
Ensembl Gene ENSMUSG00000028345
Gene Nametestis expressed gene 10
Synonymsclone 18330, 2810462N03Rik, 2610206N19Rik
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48430858-48473459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48456800 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 637 (R637Q)
Ref Sequence ENSEMBL: ENSMUSP00000132498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]
Predicted Effect probably benign
Transcript: ENSMUST00000030030
AA Change: R637Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: R637Q

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 130 235 9.7e-24 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138531
Predicted Effect probably benign
Transcript: ENSMUST00000155905
SMART Domains Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345

DomainStartEndE-ValueType
Pfam:Ipi1_N 47 152 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164866
AA Change: R637Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: R637Q

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 132 235 4.1e-25 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Tex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tex10 APN 4 48469937 nonsense probably null
IGL00832:Tex10 APN 4 48468864 missense probably benign
IGL01376:Tex10 APN 4 48456740 missense possibly damaging 0.90
IGL01594:Tex10 APN 4 48469906 missense possibly damaging 0.47
IGL02754:Tex10 APN 4 48435028 missense possibly damaging 0.46
IGL03071:Tex10 APN 4 48452946 missense probably benign 0.00
IGL03399:Tex10 APN 4 48459915 missense probably benign 0.04
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0544:Tex10 UTSW 4 48462766 splice site probably null
R0583:Tex10 UTSW 4 48451952 missense probably damaging 1.00
R0591:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0592:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0593:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0893:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1485:Tex10 UTSW 4 48436492 missense possibly damaging 0.54
R1703:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1704:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1706:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1911:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1912:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1930:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1983:Tex10 UTSW 4 48460059 missense possibly damaging 0.93
R2001:Tex10 UTSW 4 48451940 missense probably damaging 1.00
R2075:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2157:Tex10 UTSW 4 48436522 splice site probably benign
R3000:Tex10 UTSW 4 48459393 splice site probably null
R4067:Tex10 UTSW 4 48459355 nonsense probably null
R4081:Tex10 UTSW 4 48468873 missense probably benign 0.11
R4133:Tex10 UTSW 4 48468968 missense probably damaging 1.00
R4352:Tex10 UTSW 4 48452039 missense possibly damaging 0.77
R4364:Tex10 UTSW 4 48468774 missense probably benign 0.13
R4601:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4602:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4610:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4707:Tex10 UTSW 4 48468984 missense probably benign 0.00
R4744:Tex10 UTSW 4 48469990 missense probably benign 0.00
R4778:Tex10 UTSW 4 48436468 missense probably damaging 1.00
R4989:Tex10 UTSW 4 48458525 splice site probably benign
R5051:Tex10 UTSW 4 48460019 missense possibly damaging 0.86
R5120:Tex10 UTSW 4 48459272 missense possibly damaging 0.68
R5732:Tex10 UTSW 4 48460046 missense probably damaging 1.00
R5799:Tex10 UTSW 4 48433295 missense possibly damaging 0.62
R5813:Tex10 UTSW 4 48452928 missense probably benign 0.00
R6091:Tex10 UTSW 4 48459891 missense probably damaging 0.98
R6223:Tex10 UTSW 4 48468525 missense probably damaging 0.98
R6493:Tex10 UTSW 4 48436450 missense probably damaging 1.00
X0017:Tex10 UTSW 4 48460080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATTAGCAAAGTTCTAACAGCCAC -3'
(R):5'- CATTGGAAGTCATCAAGCTGC -3'

Sequencing Primer
(F):5'- TCCTAGCATTCTTAAGGCAGAGGC -3'
(R):5'- CATTTTCCTACCCCACTAGA -3'
Posted On2014-09-17