Incidental Mutation 'R2074:Tecta'
ID227442
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 42337279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1937 (Y1937*)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably null
Transcript: ENSMUST00000042190
AA Change: Y1942*
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: Y1942*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159603
Predicted Effect probably null
Transcript: ENSMUST00000160940
AA Change: Y1937*
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: Y1937*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCCTCCTTCGATGATGAAG -3'
(R):5'- TGAGGACTGCATGCCATGTC -3'

Sequencing Primer
(F):5'- CTCCTTCGATGATGAAGTACCGAAG -3'
(R):5'- GACTGCATGCCATGTCTTCCC -3'
Posted On2014-09-17