Incidental Mutation 'R2074:Dhx33'
ID227460
Institutional Source Beutler Lab
Gene Symbol Dhx33
Ensembl Gene ENSMUSG00000040620
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 33
Synonyms9430096J02Rik, 3110057P17Rik, Ddx33
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70984091-71004437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70999843 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 177 (R177W)
Ref Sequence ENSEMBL: ENSMUSP00000104167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108527] [ENSMUST00000124464] [ENSMUST00000155044]
Predicted Effect probably benign
Transcript: ENSMUST00000049048
SMART Domains Protein: ENSMUSP00000038018
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
Blast:DEXDc 41 76 3e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083312
Predicted Effect probably damaging
Transcript: ENSMUST00000108527
AA Change: R177W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104167
Gene: ENSMUSG00000040620
AA Change: R177W

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
DEXDc 53 252 1.96e-29 SMART
HELICc 300 401 3.45e-16 SMART
HA2 461 554 3.29e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123860
Predicted Effect probably benign
Transcript: ENSMUST00000124464
SMART Domains Protein: ENSMUSP00000136051
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HA2 237 330 3.29e-29 SMART
Pfam:OB_NTP_bind 364 464 7.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179635
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Dhx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dhx33 APN 11 71001620 missense probably benign
IGL01357:Dhx33 APN 11 70993861 nonsense probably null
IGL01358:Dhx33 APN 11 70993861 nonsense probably null
IGL01359:Dhx33 APN 11 70993861 nonsense probably null
IGL01360:Dhx33 APN 11 70993861 nonsense probably null
IGL01558:Dhx33 APN 11 70999753 missense probably benign 0.01
IGL02232:Dhx33 APN 11 70987204 missense probably damaging 1.00
IGL02543:Dhx33 APN 11 70987240 missense probably damaging 1.00
R0013:Dhx33 UTSW 11 70993635 missense probably damaging 0.99
R0013:Dhx33 UTSW 11 70993635 missense probably damaging 0.99
R1544:Dhx33 UTSW 11 70999528 missense probably damaging 1.00
R1782:Dhx33 UTSW 11 71001640 missense probably damaging 1.00
R1909:Dhx33 UTSW 11 70989107 missense probably benign 0.02
R3729:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R3731:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R5902:Dhx33 UTSW 11 70989131 missense probably damaging 1.00
R7129:Dhx33 UTSW 11 70993863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCACGTGCCTGAAG -3'
(R):5'- CAGTTTACTGCATTGCTGAGG -3'

Sequencing Primer
(F):5'- AATGGGCAGGAGACACACCC -3'
(R):5'- TACTGCATTGCTGAGGACAGG -3'
Posted On2014-09-17