Incidental Mutation 'R2074:Ace'
ID227464
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 1
SynonymsCD143
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105967945-105989964 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 105976623 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 484 (Q484*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
Predicted Effect probably null
Transcript: ENSMUST00000001963
AA Change: Q718*
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: Q718*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000001964
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681
AA Change: Q138*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130673
Predicted Effect probably null
Transcript: ENSMUST00000132280
AA Change: Q484*
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: Q484*

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152925
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 intron probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R3025:Ace UTSW 11 105974093 splice site probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R5838:Ace UTSW 11 105972880 missense probably benign 0.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6106:Ace UTSW 11 105989012 missense probably damaging 1.00
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
R7471:Ace UTSW 11 105973482 missense probably damaging 1.00
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTCAGGGCAAAGATACCAGC -3'
(R):5'- ACTGTTATGGGAATTGCAGAGAC -3'

Sequencing Primer
(F):5'- TCAGGGCAAAGATACCAGCCTAATG -3'
(R):5'- GACAGGACCCCTATTATTAAGACTTG -3'
Posted On2014-09-17