Incidental Mutation 'R2074:Dtnb'
ID227469
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3781273 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 658 (T658A)
Ref Sequence ENSEMBL: ENSMUSP00000126194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173542] [ENSMUST00000173736] [ENSMUST00000174290] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect probably benign
Transcript: ENSMUST00000077930
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101637
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164578
AA Change: T658A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: T658A

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164607
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172504
Predicted Effect unknown
Transcript: ENSMUST00000172598
AA Change: T488A
SMART Domains Protein: ENSMUSP00000134124
Gene: ENSMUSG00000071454
AA Change: T488A

DomainStartEndE-ValueType
Pfam:EF-hand_3 1 46 7.7e-15 PFAM
ZnF_ZZ 51 96 3.29e-15 SMART
low complexity region 217 230 N/A INTRINSIC
coiled coil region 242 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172735
Predicted Effect probably benign
Transcript: ENSMUST00000173199
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173240
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173483
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173542
SMART Domains Protein: ENSMUSP00000134036
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173736
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174290
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174414
Predicted Effect probably benign
Transcript: ENSMUST00000174547
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174639
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174663
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0449:Dtnb UTSW 12 3591971 nonsense probably null
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R4816:Dtnb UTSW 12 3749505 missense probably damaging 0.99
R5086:Dtnb UTSW 12 3632942 missense probably benign 0.19
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6724:Dtnb UTSW 12 3686817 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7078:Dtnb UTSW 12 3748480 missense possibly damaging 0.80
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGCTTTGTCCTGAG -3'
(R):5'- GTGCACACACTAGGACTAGG -3'

Sequencing Primer
(F):5'- CCCAGTGTGCTTGTGACTAACAG -3'
(R):5'- CACACTAGGACTAGGGAGAGCC -3'
Posted On2014-09-17