Incidental Mutation 'R2074:Sap130'
ID227479
Institutional Source Beutler Lab
Gene Symbol Sap130
Ensembl Gene ENSMUSG00000024260
Gene NameSin3A associated protein
Synonyms2610304F09Rik
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location31634371-31723061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31648279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 165 (I165N)
Ref Sequence ENSEMBL: ENSMUSP00000136842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025109] [ENSMUST00000178164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025109
AA Change: I165N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025109
Gene: ENSMUSG00000024260
AA Change: I165N

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
low complexity region 716 748 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 894 904 N/A INTRINSIC
low complexity region 1044 1056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178164
AA Change: I165N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136842
Gene: ENSMUSG00000024260
AA Change: I165N

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
Pfam:SAP130_C 635 1040 5.4e-224 PFAM
low complexity region 1045 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAP130 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Sap130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Sap130 APN 18 31698766 missense probably benign 0.00
IGL01060:Sap130 APN 18 31715443 missense probably damaging 1.00
IGL01668:Sap130 APN 18 31680440 missense probably damaging 0.97
IGL01797:Sap130 APN 18 31698668 missense probably damaging 0.98
IGL01872:Sap130 APN 18 31674420 missense probably damaging 0.98
IGL02010:Sap130 APN 18 31649602 missense probably damaging 0.98
PIT4142001:Sap130 UTSW 18 31667011 critical splice donor site probably null
PIT4366001:Sap130 UTSW 18 31677409 missense probably benign 0.06
R0083:Sap130 UTSW 18 31711641 missense probably damaging 1.00
R0083:Sap130 UTSW 18 31666329 splice site probably benign
R0243:Sap130 UTSW 18 31680681 splice site probably benign
R0255:Sap130 UTSW 18 31680506 missense probably damaging 1.00
R0704:Sap130 UTSW 18 31653554 missense probably damaging 0.99
R1069:Sap130 UTSW 18 31711629 missense probably damaging 0.96
R1086:Sap130 UTSW 18 31650620 splice site probably benign
R1162:Sap130 UTSW 18 31648173 missense probably damaging 1.00
R1478:Sap130 UTSW 18 31680474 missense possibly damaging 0.95
R1484:Sap130 UTSW 18 31711327 missense probably damaging 1.00
R1554:Sap130 UTSW 18 31666472 missense probably damaging 0.99
R1625:Sap130 UTSW 18 31674464 missense probably damaging 0.99
R1771:Sap130 UTSW 18 31636082 missense probably benign 0.10
R1793:Sap130 UTSW 18 31698587 missense probably benign 0.10
R1905:Sap130 UTSW 18 31680567 missense possibly damaging 0.67
R2026:Sap130 UTSW 18 31698574 missense possibly damaging 0.81
R2174:Sap130 UTSW 18 31677479 critical splice donor site probably null
R3927:Sap130 UTSW 18 31674382 missense possibly damaging 0.95
R4454:Sap130 UTSW 18 31711360 missense probably damaging 1.00
R4980:Sap130 UTSW 18 31649646 missense possibly damaging 0.95
R5222:Sap130 UTSW 18 31666703 missense probably damaging 1.00
R5345:Sap130 UTSW 18 31648198 missense probably benign 0.32
R5811:Sap130 UTSW 18 31689442 missense probably benign 0.01
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6129:Sap130 UTSW 18 31682091 missense possibly damaging 0.94
R6431:Sap130 UTSW 18 31666365 missense possibly damaging 0.95
R6930:Sap130 UTSW 18 31682088 missense possibly damaging 0.94
R6932:Sap130 UTSW 18 31666354 missense possibly damaging 0.88
X0021:Sap130 UTSW 18 31647076 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACTGGACTTGTGTGCTG -3'
(R):5'- GATGTGCTCAGCAGATACAGCC -3'

Sequencing Primer
(F):5'- GAGCAAAGCTATTGACATGTGTCCTG -3'
(R):5'- CTAACCACTAAGCAGCCTGGG -3'
Posted On2014-09-17