Incidental Mutation 'R2075:Sec16a'
ID227491
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26440239 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 588 (I588T)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: I588T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: I588T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: I588T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: I588T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTATTGGGTCCCTCTCAC -3'
(R):5'- GCTAAATCTTGAGGCCCCAGAC -3'

Sequencing Primer
(F):5'- ACCATGTTGGCACGATCTG -3'
(R):5'- TTGAGGCCCCAGACACACC -3'
Posted On2014-09-17