Incidental Mutation 'R2075:Olfr1247'
ID227494
Institutional Source Beutler Lab
Gene Symbol Olfr1247
Ensembl Gene ENSMUSG00000075081
Gene Nameolfactory receptor 1247
SynonymsMOR231-6, GA_x6K02T2Q125-51051555-51050611
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89604959-89614130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89609478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000149408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099771] [ENSMUST00000111532] [ENSMUST00000216424]
Predicted Effect probably benign
Transcript: ENSMUST00000099771
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097359
Gene: ENSMUSG00000075081
AA Change: V208A

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 4.9e-29 PFAM
Pfam:7tm_4 137 278 4.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111532
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081
AA Change: V208A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216424
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Olfr1247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1247 APN 2 89609847 missense probably benign 0.00
IGL01337:Olfr1247 APN 2 89609376 missense probably damaging 0.97
IGL02537:Olfr1247 APN 2 89609395 missense possibly damaging 0.88
IGL02651:Olfr1247 APN 2 89609498 missense possibly damaging 0.67
IGL02734:Olfr1247 APN 2 89609959 missense probably benign 0.04
IGL03177:Olfr1247 APN 2 89609482 missense probably benign 0.03
IGL03184:Olfr1247 APN 2 89609568 missense probably damaging 1.00
R0207:Olfr1247 UTSW 2 89609863 missense probably damaging 0.97
R0278:Olfr1247 UTSW 2 89609763 missense probably damaging 1.00
R0278:Olfr1247 UTSW 2 89609764 missense probably damaging 1.00
R0601:Olfr1247 UTSW 2 89609220 missense probably benign 0.00
R0633:Olfr1247 UTSW 2 89609374 missense probably benign 0.10
R1824:Olfr1247 UTSW 2 89609349 missense probably damaging 1.00
R1863:Olfr1247 UTSW 2 89609709 nonsense probably null
R2073:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R2074:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R3921:Olfr1247 UTSW 2 89609509 missense probably benign 0.00
R4559:Olfr1247 UTSW 2 89609699 missense probably damaging 0.99
R5128:Olfr1247 UTSW 2 89609303 missense probably damaging 1.00
R5140:Olfr1247 UTSW 2 89609283 missense probably damaging 1.00
R5426:Olfr1247 UTSW 2 89609739 missense probably damaging 1.00
R5896:Olfr1247 UTSW 2 89609323 missense probably damaging 0.98
R5902:Olfr1247 UTSW 2 89609251 missense probably damaging 1.00
R6478:Olfr1247 UTSW 2 89609446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTCAACATGGGAGTAATAGCTG -3'
(R):5'- GGGGATTTGCACATGCTCTG -3'

Sequencing Primer
(F):5'- AACCATGATGTGGGAGCT -3'
(R):5'- TGCACATGCTCTGGTTCAAG -3'
Posted On2014-09-17