Incidental Mutation 'R2075:Traf6'
ID227495
Institutional Source Beutler Lab
Gene Symbol Traf6
Ensembl Gene ENSMUSG00000027164
Gene NameTNF receptor-associated factor 6
SynonymsC630032O20Rik, 2310003F17Rik
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101678429-101701669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101697053 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 383 (I383L)
Ref Sequence ENSEMBL: ENSMUSP00000004949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004949]
Predicted Effect probably benign
Transcript: ENSMUST00000004949
AA Change: I383L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004949
Gene: ENSMUSG00000027164
AA Change: I383L

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RING 70 108 8.61e-9 SMART
internal_repeat_1 132 189 3.04e-6 PROSPERO
Pfam:zf-TRAF 204 261 2.6e-22 PFAM
MATH 363 490 2.87e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor associated factor (TRAF) family of adaptor proteins that mediate signaling events from members of the TNF receptor and Toll/IL-1 receptor families to activate transcription factors such as NF-kappa-B and AP-1. The product of this gene is essential for perinatal and postnatal survival. Mice deficient in this protein exhibit osteopetrosis and defective in development of epidermal appendixes, normal B cell differentiation, lymph node organogenesis, interleukin-1 signaling, lipopolysaccharide signaling and neural tube closure. This protein possesses ubiquitin ligase activity. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Viability is reduced in mice lacking both functional copies of this gene, with death occuring just before birth or around weaning. Mutants exhibit osteopetrosis and immune defects including abnormal immune cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Traf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Traf6 APN 2 101684783 missense probably benign
IGL01619:Traf6 APN 2 101690098 nonsense probably null
IGL01746:Traf6 APN 2 101696892 missense possibly damaging 0.67
IGL02071:Traf6 APN 2 101696793 missense probably benign 0.00
IGL02666:Traf6 APN 2 101697167 missense possibly damaging 0.92
IGL02693:Traf6 APN 2 101688505 missense possibly damaging 0.74
IGL02819:Traf6 APN 2 101684789 missense probably damaging 1.00
R0056:Traf6 UTSW 2 101697151 missense possibly damaging 0.81
R0390:Traf6 UTSW 2 101688588 nonsense probably null
R1470:Traf6 UTSW 2 101696649 splice site probably benign
R1727:Traf6 UTSW 2 101696739 missense probably benign
R4498:Traf6 UTSW 2 101684546 missense probably benign 0.01
R5166:Traf6 UTSW 2 101690057 missense probably benign 0.03
R5385:Traf6 UTSW 2 101684755 nonsense probably null
R5636:Traf6 UTSW 2 101696909 missense probably benign 0.06
R6005:Traf6 UTSW 2 101696684 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAAACAGTTGGAGAGTCGCC -3'
(R):5'- GGCGTATTGTACCCTGGAAG -3'

Sequencing Primer
(F):5'- GTCGCCTAGTAAGACAGGACC -3'
(R):5'- TGGAAGGGCCAGGGGAG -3'
Posted On2014-09-17