Incidental Mutation 'R2075:Tnc'
ID227504
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63995666 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1303 (T1303M)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030056
AA Change: T1303M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: T1303M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107372
AA Change: T1303M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: T1303M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107377
AA Change: T1303M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: T1303M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 unclassified probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAAGCTAGTTCCCTTGCC -3'
(R):5'- AACAGCAAATTCTCTGCCTTC -3'

Sequencing Primer
(F):5'- GTTCCCTTGCCATCTCAGAGAGAG -3'
(R):5'- AACAGCAAATTCTCTGCCTTCTTCAG -3'
Posted On2014-09-17