Incidental Mutation 'R2075:Lpcat3'
ID227516
Institutional Source Beutler Lab
Gene Symbol Lpcat3
Ensembl Gene ENSMUSG00000004270
Gene Namelysophosphatidylcholine acyltransferase 3
SynonymsMboat5, Grcc3f, Oact5
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124663027-124704418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124703103 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 380 (Y380N)
Ref Sequence ENSEMBL: ENSMUSP00000004381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004379] [ENSMUST00000004381] [ENSMUST00000128721] [ENSMUST00000203238]
Predicted Effect probably benign
Transcript: ENSMUST00000004379
SMART Domains Protein: ENSMUSP00000004379
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 45 238 2.9e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000004381
AA Change: Y380N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004381
Gene: ENSMUSG00000004270
AA Change: Y380N

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Pfam:MBOAT 126 437 1.2e-81 PFAM
transmembrane domain 454 473 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125795
Predicted Effect probably benign
Transcript: ENSMUST00000128721
SMART Domains Protein: ENSMUSP00000144738
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135516
SMART Domains Protein: ENSMUSP00000122436
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152176
Predicted Effect probably benign
Transcript: ENSMUST00000203238
SMART Domains Protein: ENSMUSP00000144730
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 55 122 1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204334
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show low blood glucose levels and postnatal death. Intestine-specific knockouts fail to thrive and show enterocyte lipid accumulation and low plasma triglycerides (TGs). Liver-specific knockouts show low plasma TGs, fatty liver, and secrete VLDL lacking arachidonoyl phospholipids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Lpcat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Lpcat3 APN 6 124699338 missense possibly damaging 0.78
IGL02279:Lpcat3 APN 6 124698109 missense probably damaging 1.00
IGL02869:Lpcat3 APN 6 124703007 missense possibly damaging 0.65
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R3757:Lpcat3 UTSW 6 124699992 splice site probably null
R4181:Lpcat3 UTSW 6 124703224 unclassified probably benign
R4583:Lpcat3 UTSW 6 124703323 missense possibly damaging 0.92
R5134:Lpcat3 UTSW 6 124702530 missense probably benign 0.00
R5159:Lpcat3 UTSW 6 124699394 intron probably benign
R6703:Lpcat3 UTSW 6 124663222 missense probably benign 0.02
R6833:Lpcat3 UTSW 6 124700011 missense probably damaging 1.00
X0017:Lpcat3 UTSW 6 124698118 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCAGCACTCTACTCCTCAGG -3'
(R):5'- CCATGAACAGCCAGTGGATG -3'

Sequencing Primer
(F):5'- TCTACTCCTCAGGGCAGAC -3'
(R):5'- TCTGTTGCACCAAGTAGTAGAAG -3'
Posted On2014-09-17