Incidental Mutation 'R2075:Cd22'
ID227520
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene NameCD22 antigen
SynonymsLyb-8, Lyb8
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30865402-30880342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30869698 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 637 (C637S)
Ref Sequence ENSEMBL: ENSMUSP00000139871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]
Predicted Effect probably damaging
Transcript: ENSMUST00000019248
AA Change: C637S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: C637S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108125
AA Change: C637S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: C637S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186154
AA Change: C637S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: C637S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably damaging
Transcript: ENSMUST00000189718
AA Change: C637S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: C637S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably damaging
Transcript: ENSMUST00000190617
AA Change: C637S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: C637S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190646
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214289
AA Change: C463S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTACAGTAGACAGTGAGGGTGC -3'
(R):5'- CATGGTCAACAACTCCATCGG -3'

Sequencing Primer
(F):5'- GCTGGGTGGTGACTCTCC -3'
(R):5'- CATCGGAGAGACCTTGTCACAG -3'
Posted On2014-09-17