Incidental Mutation 'R2075:Dhx32'
ID227524
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 32
SynonymsDdx32
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133720942-133782726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133721292 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 731 (N731S)
Ref Sequence ENSEMBL: ENSMUSP00000066067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033282] [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably benign
Transcript: ENSMUST00000033282
SMART Domains Protein: ENSMUSP00000033282
Gene: ENSMUSG00000030983

DomainStartEndE-ValueType
Pfam:BCIP 58 258 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033290
AA Change: N731S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: N731S

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063669
AA Change: N731S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: N731S

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106139
AA Change: N591S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986
AA Change: N591S

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151711
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133748977 missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133759525 missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133737421 missense probably benign 0.01
R1054:Dhx32 UTSW 7 133725272 missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133737340 missense possibly damaging 0.87
R1532:Dhx32 UTSW 7 133749024 missense possibly damaging 0.93
R1864:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R1865:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R2074:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2119:Dhx32 UTSW 7 133722247 nonsense probably null
R2377:Dhx32 UTSW 7 133724478 missense probably damaging 1.00
R3125:Dhx32 UTSW 7 133725356 missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133734109 missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133738655 intron probably benign
R5538:Dhx32 UTSW 7 133723217 missense probably benign
R5616:Dhx32 UTSW 7 133721228 makesense probably null
R5951:Dhx32 UTSW 7 133737328 missense probably damaging 0.98
R6081:Dhx32 UTSW 7 133722212 missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133742800 missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133737226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGTAGGGTTCTGTTCCATGTG -3'
(R):5'- AAGTCTGCACATGCTCCCAG -3'

Sequencing Primer
(F):5'- TCTGTTCCATGTGTCTGTGAC -3'
(R):5'- ACATGCTCCCAGGGCTG -3'
Posted On2014-09-17