Incidental Mutation 'R2075:Anln'
ID227534
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Nameanillin, actin binding protein
Synonyms1110037A17Rik, 2900037I21Rik, Scraps
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2075 (G1)
Quality Score219
Status Not validated
Chromosome9
Chromosomal Location22332012-22389188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22333168 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 1083 (W1083L)
Ref Sequence ENSEMBL: ENSMUSP00000045873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912] [ENSMUST00000215006]
Predicted Effect probably benign
Transcript: ENSMUST00000040912
AA Change: W1083L

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: W1083L

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215006
AA Change: W226L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217010
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1856:Anln UTSW 9 22353331 missense probably damaging 1.00
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6146:Anln UTSW 9 22376308 nonsense probably null
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6264:Anln UTSW 9 22334117 missense possibly damaging 0.82
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAATCTGCTGCTTCTAACTGTC -3'
(R):5'- TCATTATGAATGGTGGCGCAC -3'

Sequencing Primer
(F):5'- GCTGCTTCTAACTGTCTTCTTAAG -3'
(R):5'- CCATTGTACAGAGAAGCACTTCCTTG -3'
Posted On2014-09-17