Incidental Mutation 'R2075:Ddx10'
ID227536
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Synonyms4632415A01Rik
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53098635-53248053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53240505 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 73 (D73E)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
Predicted Effect probably benign
Transcript: ENSMUST00000065630
AA Change: D73E

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: D73E

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53160026 splice site probably benign
IGL01111:Ddx10 APN 9 53159948 missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53204130 missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53229198 missense probably benign 0.16
IGL02036:Ddx10 APN 9 53204183 missense probably benign 0.00
IGL02236:Ddx10 APN 9 53235382 missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53204279 missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53117152 critical splice donor site probably null
R0279:Ddx10 UTSW 9 53235304 missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53240487 missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53233997 missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53117199 nonsense probably null
R1548:Ddx10 UTSW 9 53149561 critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53159953 missense probably benign 0.25
R1720:Ddx10 UTSW 9 53238071 missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53207545 missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53240475 critical splice donor site probably null
R2007:Ddx10 UTSW 9 53213278 missense probably benign 0.06
R2073:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2133:Ddx10 UTSW 9 53149512 missense probably benign 0.13
R4660:Ddx10 UTSW 9 53236398 critical splice donor site probably null
R4668:Ddx10 UTSW 9 53099213 missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53233931 missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53204105 missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53233857 nonsense probably null
R5655:Ddx10 UTSW 9 53209687 critical splice donor site probably null
R5874:Ddx10 UTSW 9 53229198 missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53204251 missense probably benign 0.00
R6534:Ddx10 UTSW 9 53223688 missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53247907 nonsense probably null
X0019:Ddx10 UTSW 9 53233996 missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53225573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGAAAGCTCAATCAGTAACG -3'
(R):5'- AATGAGGTTGCTCCATGGTAC -3'

Sequencing Primer
(F):5'- GCTCAATCAGTAACGTGCATG -3'
(R):5'- TTTATTTAGAAGTGATGGTATGCTCC -3'
Posted On2014-09-17