Incidental Mutation 'R2075:Bahcc1'
ID227552
Institutional Source Beutler Lab
Gene Symbol Bahcc1
Ensembl Gene ENSMUSG00000039741
Gene NameBAH domain and coiled-coil containing 1
SynonymsKIAA1447
MMRRC Submission 040080-MU
Accession Numbers

Genbank: NM_198423; MGI: 2679272

Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120232947-120292296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120271689 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 271 (C271Y)
Ref Sequence ENSEMBL: ENSMUSP00000112827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044985] [ENSMUST00000118987] [ENSMUST00000122148]
Predicted Effect probably damaging
Transcript: ENSMUST00000044985
AA Change: C271Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043643
Gene: ENSMUSG00000039741
AA Change: C271Y

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118987
AA Change: C271Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112784
Gene: ENSMUSG00000039741
AA Change: C271Y

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122148
AA Change: C271Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112827
Gene: ENSMUSG00000039741
AA Change: C271Y

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality for the majority of mutants. Those that survive exhibit hind leg motor dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(2) Gene trapped(24)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Bahcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bahcc1 APN 11 120272304 missense probably damaging 1.00
IGL00536:Bahcc1 APN 11 120285045 missense probably damaging 0.96
IGL01339:Bahcc1 APN 11 120289512 missense probably damaging 1.00
IGL01695:Bahcc1 APN 11 120276609 missense probably benign 0.02
IGL01744:Bahcc1 APN 11 120271737 missense probably benign 0.02
IGL01769:Bahcc1 APN 11 120280204 splice site probably benign
IGL01982:Bahcc1 APN 11 120287473 missense probably damaging 1.00
IGL02341:Bahcc1 APN 11 120272520 missense probably damaging 1.00
IGL02535:Bahcc1 APN 11 120287536 missense possibly damaging 0.88
IGL02559:Bahcc1 APN 11 120285172 missense probably damaging 0.97
IGL02579:Bahcc1 APN 11 120285349 splice site probably benign
IGL02609:Bahcc1 APN 11 120289398 missense possibly damaging 0.93
IGL02678:Bahcc1 APN 11 120272871 missense probably damaging 1.00
IGL02800:Bahcc1 APN 11 120272934 missense probably damaging 1.00
IGL02963:Bahcc1 APN 11 120274932 missense possibly damaging 0.86
IGL03128:Bahcc1 APN 11 120268434 splice site probably benign
IGL03242:Bahcc1 APN 11 120268300 splice site probably benign
IGL03248:Bahcc1 APN 11 120268409 missense probably damaging 1.00
R0019:Bahcc1 UTSW 11 120289771 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0148:Bahcc1 UTSW 11 120268404 missense probably damaging 1.00
R0164:Bahcc1 UTSW 11 120285074 splice site probably benign
R0321:Bahcc1 UTSW 11 120273425 critical splice donor site probably null
R0671:Bahcc1 UTSW 11 120287320 missense probably damaging 1.00
R0737:Bahcc1 UTSW 11 120272841 missense probably damaging 1.00
R1452:Bahcc1 UTSW 11 120282239 splice site probably benign
R1570:Bahcc1 UTSW 11 120272183 missense possibly damaging 0.74
R1914:Bahcc1 UTSW 11 120285399 missense probably damaging 1.00
R2010:Bahcc1 UTSW 11 120272778 missense probably damaging 1.00
R2085:Bahcc1 UTSW 11 120288082 missense probably damaging 1.00
R3552:Bahcc1 UTSW 11 120276772 missense possibly damaging 0.90
R3711:Bahcc1 UTSW 11 120275097 missense probably benign 0.27
R3804:Bahcc1 UTSW 11 120283358 missense probably benign 0.01
R4349:Bahcc1 UTSW 11 120259201 missense probably damaging 1.00
R4557:Bahcc1 UTSW 11 120275088 missense probably damaging 1.00
R4801:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4802:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4908:Bahcc1 UTSW 11 120287754 missense probably benign 0.36
R4941:Bahcc1 UTSW 11 120286665 missense probably benign
R5217:Bahcc1 UTSW 11 120274459 nonsense probably null
R5241:Bahcc1 UTSW 11 120271403 missense probably damaging 1.00
R5432:Bahcc1 UTSW 11 120287988 missense probably benign 0.02
R5696:Bahcc1 UTSW 11 120273987 missense probably damaging 1.00
R5724:Bahcc1 UTSW 11 120285366 missense possibly damaging 0.78
R5725:Bahcc1 UTSW 11 120274888 missense probably benign
R5788:Bahcc1 UTSW 11 120286352 missense probably damaging 1.00
R5893:Bahcc1 UTSW 11 120285430 missense probably damaging 0.99
R5900:Bahcc1 UTSW 11 120284493 missense probably damaging 1.00
R6014:Bahcc1 UTSW 11 120289789 missense probably benign 0.00
R6058:Bahcc1 UTSW 11 120287385 missense probably damaging 1.00
R6107:Bahcc1 UTSW 11 120272888 missense probably benign 0.00
R6302:Bahcc1 UTSW 11 120276808 missense probably damaging 1.00
R6525:Bahcc1 UTSW 11 120285222 missense probably damaging 1.00
R6550:Bahcc1 UTSW 11 120276651 missense possibly damaging 0.94
R6822:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R6836:Bahcc1 UTSW 11 120271757 nonsense probably null
R6846:Bahcc1 UTSW 11 120271596 missense possibly damaging 0.92
R6916:Bahcc1 UTSW 11 120273009 missense probably damaging 1.00
R6966:Bahcc1 UTSW 11 120283159 missense probably damaging 0.99
X0026:Bahcc1 UTSW 11 120271752 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTTGACCGCTTCCTCATGGG -3'
(R):5'- CTGTGTAGGATACAGCATGATGC -3'

Sequencing Primer
(F):5'- ACCGCTTCCTCATGGGTAAAGAG -3'
(R):5'- AGGCACTCACTGAAGGCTG -3'
Posted On2014-09-17