Mutagenetix > Incidental Mutation

Incidental Mutation 'R2075:Piezo2'

227577

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik

MMRRC Submission

040080-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2075 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63143284-63520254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 63214805 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1263 (E1263K)

Ref Sequence

ENSEMBL: ENSMUSP00000138758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: E1277K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: E1277K

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182233
AA Change: E1045K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: E1045K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183217
AA Change: E1263K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: E1263K

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,472,382 (GRCm39)	F4263L	probably damaging	Het
Aebp2	G	A	6: 140,579,420 (GRCm39)	S219N	probably benign	Het
Anln	C	A	9: 22,244,464 (GRCm39)	W1083L	probably benign	Het
Atic	T	A	1: 71,615,286 (GRCm39)	D438E	probably benign	Het
Bahcc1	G	A	11: 120,162,515 (GRCm39)	C271Y	probably damaging	Het
Btbd17	A	T	11: 114,682,778 (GRCm39)		probably null	Het
Ccdc122	T	C	14: 77,306,391 (GRCm39)		probably null	Het
Ccdc149	A	G	5: 52,596,510 (GRCm39)	L34P	probably damaging	Het
Cd22	C	G	7: 30,569,123 (GRCm39)	C637S	probably damaging	Het
Ces1a	T	A	8: 93,774,703 (GRCm39)	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,934,761 (GRCm39)	M65K	probably damaging	Het
Clec16a	G	A	16: 10,559,480 (GRCm39)	A918T	probably benign	Het
Clec2m	C	T	6: 129,303,666 (GRCm39)	E100K	probably benign	Het
Cnot1	G	T	8: 96,466,461 (GRCm39)	T1592K	possibly damaging	Het
Ddx10	A	T	9: 53,151,805 (GRCm39)	D73E	probably benign	Het
Dhx32	T	C	7: 133,323,021 (GRCm39)	N731S	probably benign	Het
Dmd	G	C	X: 83,356,089 (GRCm39)	A2257P	probably benign	Het
Dna2	A	G	10: 62,805,601 (GRCm39)	Q946R	probably benign	Het
Dnai4	G	A	4: 102,907,390 (GRCm39)	T632M	probably damaging	Het
Duox2	T	A	2: 122,125,639 (GRCm39)	S323C	probably damaging	Het
Esr2	A	G	12: 76,212,221 (GRCm39)		probably null	Het
Fbxo9	G	T	9: 77,991,798 (GRCm39)	H397N	possibly damaging	Het
Fsip2	T	A	2: 82,818,923 (GRCm39)	N4885K	possibly damaging	Het
Gm12695	T	C	4: 96,612,182 (GRCm39)	Y527C	possibly damaging	Het
Hivep1	A	G	13: 42,309,794 (GRCm39)	D678G	probably damaging	Het
Hmcn1	T	A	1: 150,453,074 (GRCm39)	I5414F	possibly damaging	Het
Hspb2	T	C	9: 50,662,646 (GRCm39)	Y67C	probably benign	Het
Kbtbd8	T	A	6: 95,103,664 (GRCm39)	C438S	possibly damaging	Het
Kif5a	T	C	10: 127,081,238 (GRCm39)	D232G	probably damaging	Het
Ky	A	G	9: 102,419,945 (GRCm39)	S651G	probably damaging	Het
Lgals12	T	C	19: 7,576,210 (GRCm39)	D238G	possibly damaging	Het
Lpcat3	T	A	6: 124,680,066 (GRCm39)	Y380N	probably damaging	Het
Mdn1	A	G	4: 32,716,058 (GRCm39)	H2080R	probably benign	Het
Mex3c	C	T	18: 73,722,840 (GRCm39)	S311L	probably benign	Het
Mlh3	A	T	12: 85,315,915 (GRCm39)	Y90*	probably null	Het
Mpped2	T	A	2: 106,575,147 (GRCm39)	Y77*	probably null	Het
Myo5a	A	T	9: 75,097,200 (GRCm39)	T49S	probably benign	Het
Nsd1	T	C	13: 55,458,313 (GRCm39)	V2142A	possibly damaging	Het
Or4a74	A	G	2: 89,439,822 (GRCm39)	V208A	probably benign	Het
Or51b17	T	A	7: 103,542,127 (GRCm39)	I272F	probably damaging	Het
Or51i2	T	A	7: 103,689,180 (GRCm39)	M59K	probably damaging	Het
Or5ac19	T	C	16: 59,089,274 (GRCm39)	Y252C	possibly damaging	Het
Pdgfra	T	C	5: 75,348,609 (GRCm39)	I883T	probably damaging	Het
Pdzd2	A	G	15: 12,385,905 (GRCm39)	L955P	probably damaging	Het
Phf24	A	G	4: 42,939,507 (GRCm39)	Y333C	possibly damaging	Het
Phlpp2	T	C	8: 110,655,124 (GRCm39)	S605P	possibly damaging	Het
Pitrm1	A	G	13: 6,605,419 (GRCm39)	T149A	probably damaging	Het
Pkhd1l1	G	T	15: 44,422,035 (GRCm39)	A3102S	probably damaging	Het
Plch2	A	T	4: 155,074,366 (GRCm39)	L754Q	probably damaging	Het
Polr2c	A	G	8: 95,590,195 (GRCm39)	I267V	probably benign	Het
Potefam1	T	C	2: 111,030,763 (GRCm39)	E382G	probably damaging	Het
Prss8	C	A	7: 127,526,266 (GRCm39)	R148L	possibly damaging	Het
Ptpn2	T	A	18: 67,814,545 (GRCm39)	T155S	probably damaging	Het
Ptprn2	G	A	12: 117,211,337 (GRCm39)	V839I	probably benign	Het
Sbp	A	G	17: 24,164,132 (GRCm39)		probably null	Het
Sec16a	A	G	2: 26,330,251 (GRCm39)	I588T	probably damaging	Het
Six2	A	G	17: 85,994,933 (GRCm39)	S150P	probably damaging	Het
Slc5a5	C	T	8: 71,345,083 (GRCm39)	G75R	possibly damaging	Het
Slc6a20b	T	A	9: 123,424,099 (GRCm39)	T623S	probably benign	Het
Sqle	T	A	15: 59,195,750 (GRCm39)	V342E	probably damaging	Het
Stk3	T	C	15: 34,959,195 (GRCm39)	M256V	possibly damaging	Het
Tek	A	G	4: 94,715,966 (GRCm39)	I463V	probably benign	Het
Tex10	C	T	4: 48,456,800 (GRCm39)	R637Q	probably benign	Het
Tnc	G	A	4: 63,913,903 (GRCm39)	T1303M	possibly damaging	Het
Traf6	A	C	2: 101,527,398 (GRCm39)	I383L	probably benign	Het
Tubb3	C	T	8: 124,148,009 (GRCm39)	A314V	probably damaging	Het
Vmn1r199	A	T	13: 22,567,435 (GRCm39)	Y243F	probably damaging	Het
Vmn2r111	A	C	17: 22,778,043 (GRCm39)	N545K	probably damaging	Het
Vmn2r27	T	A	6: 124,177,510 (GRCm39)	Q498L	possibly damaging	Het
Vstm4	A	T	14: 32,639,811 (GRCm39)	S229C	probably damaging	Het
Wdr12	C	T	1: 60,130,222 (GRCm39)	R63Q	possibly damaging	Het
Wrn	T	A	8: 33,812,357 (GRCm39)	I187L	probably benign	Het
Xirp2	A	T	2: 67,340,545 (GRCm39)	I929L	probably benign	Het
Ywhae	T	A	11: 75,655,486 (GRCm39)	D252E	probably benign	Het
Zfp944	A	T	17: 22,558,178 (GRCm39)	C356*	probably null	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,250,770 (GRCm39)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,155,531 (GRCm39)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,203,101 (GRCm39)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,257,685 (GRCm39)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,163,463 (GRCm39)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,315,904 (GRCm39)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,160,630 (GRCm39)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,216,241 (GRCm39)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,175,859 (GRCm39)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,225,915 (GRCm39)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,153,705 (GRCm39)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,279,915 (GRCm39)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,205,933 (GRCm39)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,165,995 (GRCm39)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,157,546 (GRCm39)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,207,730 (GRCm39)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,197,856 (GRCm39)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,257,731 (GRCm39)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,203,146 (GRCm39)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,163,343 (GRCm39)	splice site	probably null
IGL03129:Piezo2	APN	18	63,248,043 (GRCm39)	missense	probably benign
IGL03143:Piezo2	APN	18	63,241,147 (GRCm39)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,144,669 (GRCm39)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,257,677 (GRCm39)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,186,133 (GRCm39)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,174,791 (GRCm39)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,144,609 (GRCm39)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,154,379 (GRCm39)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,160,775 (GRCm39)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
sopranino	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
woodwind	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,519,271 (GRCm39)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,157,540 (GRCm39)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,235,155 (GRCm39)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,157,562 (GRCm39)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,162,132 (GRCm39)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,235,245 (GRCm39)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,157,522 (GRCm39)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,160,615 (GRCm39)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,155,552 (GRCm39)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,155,497 (GRCm39)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,152,329 (GRCm39)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,174,794 (GRCm39)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,216,306 (GRCm39)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,148,873 (GRCm39)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,219,824 (GRCm39)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,154,325 (GRCm39)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,216,202 (GRCm39)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,277,990 (GRCm39)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,215,986 (GRCm39)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,250,743 (GRCm39)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,154,244 (GRCm39)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,239,355 (GRCm39)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,241,158 (GRCm39)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,165,911 (GRCm39)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,152,415 (GRCm39)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,247,031 (GRCm39)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,211,911 (GRCm39)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,211,852 (GRCm39)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,277,997 (GRCm39)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,192,815 (GRCm39)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,252,006 (GRCm39)	missense	possibly damaging	0.62
R2078:Piezo2	UTSW	18	63,250,791 (GRCm39)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,247,112 (GRCm39)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,239,345 (GRCm39)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,155,596 (GRCm39)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,378,695 (GRCm39)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,186,106 (GRCm39)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,279,914 (GRCm39)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,157,506 (GRCm39)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,175,903 (GRCm39)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,214,864 (GRCm39)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,183,675 (GRCm39)	missense	probably benign
R4181:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,217,911 (GRCm39)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,235,170 (GRCm39)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,247,134 (GRCm39)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,205,951 (GRCm39)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,219,699 (GRCm39)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,203,034 (GRCm39)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,278,025 (GRCm39)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,211,862 (GRCm39)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,290,333 (GRCm39)	missense	probably benign
R4961:Piezo2	UTSW	18	63,186,032 (GRCm39)	splice site	probably null
R4968:Piezo2	UTSW	18	63,278,042 (GRCm39)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,207,751 (GRCm39)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,216,184 (GRCm39)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,157,607 (GRCm39)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,207,691 (GRCm39)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,163,480 (GRCm39)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,166,000 (GRCm39)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,197,802 (GRCm39)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,217,811 (GRCm39)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,278,176 (GRCm39)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,160,935 (GRCm39)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,144,792 (GRCm39)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,278,162 (GRCm39)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,250,768 (GRCm39)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,250,767 (GRCm39)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,279,927 (GRCm39)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,160,972 (GRCm39)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,247,005 (GRCm39)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,145,716 (GRCm39)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,290,281 (GRCm39)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,254,341 (GRCm39)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,250,749 (GRCm39)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,239,364 (GRCm39)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,219,678 (GRCm39)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,174,734 (GRCm39)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,239,342 (GRCm39)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,154,399 (GRCm39)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,154,333 (GRCm39)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,165,960 (GRCm39)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,223,950 (GRCm39)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,166,057 (GRCm39)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,216,032 (GRCm39)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,278,181 (GRCm39)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,257,780 (GRCm39)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,241,101 (GRCm39)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,150,590 (GRCm39)	splice site	probably null
R7395:Piezo2	UTSW	18	63,160,634 (GRCm39)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,157,543 (GRCm39)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,145,794 (GRCm39)	missense	probably benign
R7517:Piezo2	UTSW	18	63,215,996 (GRCm39)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,186,081 (GRCm39)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,175,610 (GRCm39)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,246,947 (GRCm39)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,216,016 (GRCm39)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,216,271 (GRCm39)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,175,882 (GRCm39)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,163,537 (GRCm39)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,208,801 (GRCm39)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,145,857 (GRCm39)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,217,759 (GRCm39)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,178,611 (GRCm39)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,279,873 (GRCm39)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,225,971 (GRCm39)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,226,086 (GRCm39)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8727:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8810:Piezo2	UTSW	18	63,248,034 (GRCm39)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,248,096 (GRCm39)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,225,902 (GRCm39)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,178,550 (GRCm39)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,250,815 (GRCm39)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,290,302 (GRCm39)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,154,372 (GRCm39)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,208,868 (GRCm39)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,157,637 (GRCm39)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,162,156 (GRCm39)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,235,236 (GRCm39)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,519,347 (GRCm39)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,280,016 (GRCm39)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,248,108 (GRCm39)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,197,767 (GRCm39)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,160,657 (GRCm39)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,183,681 (GRCm39)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,150,648 (GRCm39)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,203,065 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATATAACTCAGAGGCTCATCGGC -3'
(R):5'- ACCTTAGAAAGTGGCATGCGC -3'

Sequencing Primer
(F):5'- GGCTTCTGCTGTGGTCCAC -3'
(R):5'- ACAAGTGACCTAGGCGCTCAG -3'

Posted On

2014-09-17