Incidental Mutation 'R2127:Atp2b2'
ID227610
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113760650 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 921 (L921P)
Ref Sequence ENSEMBL: ENSMUSP00000145174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect probably damaging
Transcript: ENSMUST00000089003
AA Change: L925P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: L925P

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101044
AA Change: L970P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: L970P

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101045
AA Change: L925P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: L925P

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152831
AA Change: L925P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: L925P

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205052
AA Change: L921P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: L921P

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0116:Atp2b2 UTSW 6 113793695 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113813888 missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113793888 splice site probably null
R1248:Atp2b2 UTSW 6 113817192 missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113789757 missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113765732 missense possibly damaging 0.89
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTACTGCTGGCTTTGAGG -3'
(R):5'- AGATGCTCTGGGTGAACCTC -3'

Sequencing Primer
(F):5'- ACAGGGCATGACAACTTCTG -3'
(R):5'- GTGAACCTCATCATGGACACGTTTG -3'
Posted On2014-09-17