Incidental Mutation 'R2128:Utp20'
ID227745
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88814055 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 431 (F431S)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: F431S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: F431S

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCGATCCAATCATCATTTTGGGTAG -3'
(R):5'- TCACAGTGTTCCCAGAATGGC -3'

Sequencing Primer
(F):5'- CCAATCATCATTTTGGGTAGTATGC -3'
(R):5'- CTGGCCATATTGTCTCCATGGAG -3'
Posted On2014-09-17