Incidental Mutation 'R2128:Dync1h1'
ID227759
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110640882 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2636 (Y2636H)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: Y2636H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: Y2636H

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172218
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 unclassified probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
gymnast UTSW 12 110618368 missense probably damaging 1.00
lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110616807 missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110655528 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4780:Dync1h1 UTSW 12 110661196 missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110646205 missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense not run
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAAGACCATGACACTCTTCAG -3'
(R):5'- TGTAAAGTTAGCAAGCTGTGGATG -3'

Sequencing Primer
(F):5'- TTCAGTGCTCTCCGGGC -3'
(R):5'- CAAGCTGTGGATGAGCGCTG -3'
Posted On2014-09-17