Incidental Mutation 'R2128:Dnah5'
ID227772
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Namedynein, axonemal, heavy chain 5
Synonymsb2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 040131-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location28203752-28472052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28408321 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 3484 (Q3484R)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: Q3484R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: Q3484R

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 intron probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTAGGCTCAAGGCACTG -3'
(R):5'- TTGATTCATGCTTAGGGCCTC -3'

Sequencing Primer
(F):5'- CACAGTCATACAAAGCTAGAATCTTG -3'
(R):5'- ATGCTTAGGGCCTCTGACAC -3'
Posted On2014-09-17