Incidental Mutation 'R2129:Ryr3'
ID227803
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Nameryanodine receptor 3
Synonymscalcium release channel isoform 3
MMRRC Submission 040132-MU
Accession Numbers

Genbank: NM_177652.2

Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R2129 (G1)
Quality Score149
Status Validated
Chromosome2
Chromosomal Location112631355-113217096 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 112678370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
Predicted Effect probably benign
Transcript: ENSMUST00000080673
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091818
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134358
Predicted Effect probably benign
Transcript: ENSMUST00000208151
Predicted Effect probably benign
Transcript: ENSMUST00000208290
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112660149 missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112663012 splice site probably benign
IGL00785:Ryr3 APN 2 112836103 missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112886589 missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112728934 splice site probably benign
IGL00970:Ryr3 APN 2 112764676 missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112751846 splice site probably benign
IGL01105:Ryr3 APN 2 112751805 missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112709073 missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112660054 missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112672248 missense probably benign 0.20
IGL01552:Ryr3 APN 2 112825883 missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112772728 missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112650111 critical splice donor site probably null
IGL01837:Ryr3 APN 2 112801320 missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112803158 splice site probably benign
IGL01907:Ryr3 APN 2 112869001 splice site probably benign
IGL02005:Ryr3 APN 2 112663263 splice site probably benign
IGL02014:Ryr3 APN 2 112946915 missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112949157 missense probably benign
IGL02178:Ryr3 APN 2 112825799 missense probably benign 0.17
IGL02185:Ryr3 APN 2 112967203 missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112754838 splice site probably benign
IGL02200:Ryr3 APN 2 112849510 missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112964356 missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112645277 missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112834114 missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112847399 critical splice donor site probably null
IGL02340:Ryr3 APN 2 112947004 splice site probably benign
IGL02398:Ryr3 APN 2 112847422 missense probably benign 0.05
IGL02407:Ryr3 APN 2 112754958 missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112900905 missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112833990 missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112681728 splice site probably benign
IGL02585:Ryr3 APN 2 112712303 missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112902576 critical splice donor site probably null
IGL02817:Ryr3 APN 2 112844623 critical splice donor site probably null
IGL02861:Ryr3 APN 2 112652841 missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112668120 missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112800047 missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112675974 splice site probably benign
IGL03137:Ryr3 APN 2 112910397 missense probably benign
IGL03166:Ryr3 APN 2 112641112 nonsense probably null
IGL03177:Ryr3 APN 2 113028671 missense probably benign 0.39
IGL03205:Ryr3 APN 2 112632142 missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112954336 nonsense probably null
IGL03249:Ryr3 APN 2 112640656 missense probably benign 0.32
IGL03370:Ryr3 APN 2 112756599 missense possibly damaging 0.69
ANU74:Ryr3 UTSW 2 112831230 critical splice acceptor site probably null
F5426:Ryr3 UTSW 2 112766338 splice site probably benign
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112859763 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112803165 missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112686810 missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112647123 splice site probably benign
R0306:Ryr3 UTSW 2 112775655 critical splice donor site probably null
R0445:Ryr3 UTSW 2 112866054 missense probably benign 0.16
R0463:Ryr3 UTSW 2 112661701 missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112678481 missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112662555 missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112648306 splice site probably benign
R0735:Ryr3 UTSW 2 112732982 missense probably benign 0.11
R0783:Ryr3 UTSW 2 112756327 splice site probably benign
R0789:Ryr3 UTSW 2 112780973 splice site probably null
R0835:Ryr3 UTSW 2 112650138 missense probably benign 0.16
R0879:Ryr3 UTSW 2 113030243 missense probably benign 0.02
R0924:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112653702 missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112869108 missense probably benign 0.42
R1169:Ryr3 UTSW 2 112733014 missense probably benign 0.01
R1170:Ryr3 UTSW 2 112946987 missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112964380 missense probably benign 0.00
R1187:Ryr3 UTSW 2 112958176 missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112645285 missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112779963 missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112750803 missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112645259 missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112757701 missense probably benign 0.18
R1467:Ryr3 UTSW 2 112753002 splice site probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1474:Ryr3 UTSW 2 112909962 missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112636522 splice site probably benign
R1513:Ryr3 UTSW 2 112709197 nonsense probably null
R1524:Ryr3 UTSW 2 112869082 missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112678090 missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112653505 missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112900833 missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112709273 missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112860460 missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112751768 critical splice donor site probably null
R1776:Ryr3 UTSW 2 112957253 missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112867292 missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112750820 missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112730328 missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112709137 missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112794467 missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112654492 missense probably null 0.93
R2018:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2019:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2029:Ryr3 UTSW 2 112647016 missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112756641 missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112954364 missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112663004 missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112946957 missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112638129 missense probably damaging 1.00
R2140:Ryr3 UTSW 2 112875148 missense probably benign 0.01
R2176:Ryr3 UTSW 2 112666335 missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112801392 missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112686628 missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112675904 missense probably benign 0.18
R2568:Ryr3 UTSW 2 112675874 missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112640281 missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112656531 missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112751787 missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112754913 missense probably benign
R3909:Ryr3 UTSW 2 112636608 missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112841873 missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 113028703 splice site probably benign
R3927:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112675837 missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112900908 missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112926983 splice site probably null
R4156:Ryr3 UTSW 2 112653675 missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112794470 missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112910407 missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112946844 missense probably benign 0.01
R4409:Ryr3 UTSW 2 112730308 missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112831224 missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112653102 missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112653621 missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112755174 splice site probably null
R4589:Ryr3 UTSW 2 112875133 missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112652763 missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112996555 intron probably benign
R4710:Ryr3 UTSW 2 112766301 missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112910502 missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112803268 missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112757639 missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112733031 critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112912236 missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112652745 missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112648373 missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112908462 missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112831185 missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112836257 missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112635777 missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112909973 missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112640171 missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112831159 missense probably benign 0.00
R5112:Ryr3 UTSW 2 112902665 missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112646927 missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112670660 missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112757667 missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112755150 missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112844711 missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112718002 missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112653213 missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112902693 missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112834125 missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112775841 splice site probably null
R5434:Ryr3 UTSW 2 112794469 missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112730302 splice site probably null
R5501:Ryr3 UTSW 2 112662504 missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112754877 missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112841948 missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112900984 nonsense probably null
R5731:Ryr3 UTSW 2 112641572 missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112753097 missense probably benign 0.05
R5783:Ryr3 UTSW 2 112652998 missense probably benign 0.06
R5799:Ryr3 UTSW 2 112686580 missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112859731 missense probably damaging 1.00
R5883:Ryr3 UTSW 2 113030292 intron probably benign
R5911:Ryr3 UTSW 2 112908487 missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112647049 missense probably benign 0.22
R5972:Ryr3 UTSW 2 112834064 missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112672269 missense probably benign 0.00
R6084:Ryr3 UTSW 2 112908493 missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112635396 missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112757670 missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112954294 critical splice donor site probably null
R6157:Ryr3 UTSW 2 112841899 missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112656544 missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112632185 missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112675933 missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112660068 missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112867378 missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112753088 missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112652610 missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112946906 missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112958175 missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112860354 missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112831200 missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112686825 missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112766311 missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112875091 missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112753078 missense probably benign 0.00
R7037:Ryr3 UTSW 2 112949130 nonsense probably null
X0057:Ryr3 UTSW 2 112640159 missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112912302 missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112900916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGGAACTTTCTTAGAAGAAC -3'
(R):5'- TTCAGAGAGTCACTGAGCCC -3'

Sequencing Primer
(F):5'- CAGGAGAGATGTAAATGAGACTTACC -3'
(R):5'- AGAGAGTCACTGAGCCCCTCTC -3'
Posted On2014-09-17