Incidental Mutation 'R2129:Kif1b'
ID227821
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 040132-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149187640 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1568 (S1568L)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably benign
Transcript: ENSMUST00000055647
AA Change: S1522L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: S1522L

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060537
AA Change: S1568L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: S1568L

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139123
AA Change: S246L
SMART Domains Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: S246L

DomainStartEndE-ValueType
Pfam:DUF3694 1 92 4.4e-23 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 204 232 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
PH 381 480 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150853
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGAAGGTAAGGACTGACC -3'
(R):5'- ACGATGTTCCTCTTGTCAGG -3'

Sequencing Primer
(F):5'- AGGTAAGGACTGACCCTTATTATTTC -3'
(R):5'- AAAAACTCGCCACTTCTTGCTG -3'
Posted On2014-09-17