Incidental Mutation 'R2129:Smo'
ID227832
Institutional Source Beutler Lab
Gene Symbol Smo
Ensembl Gene ENSMUSG00000001761
Gene Namesmoothened, frizzled class receptor
SynonymsE130215L21Rik
MMRRC Submission 040132-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29735503-29761365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29757314 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 476 (Y476C)
Ref Sequence ENSEMBL: ENSMUSP00000001812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001812]
Predicted Effect probably damaging
Transcript: ENSMUST00000001812
AA Change: Y476C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: Y476C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
FRI 73 187 5.48e-49 SMART
Frizzled 224 559 2.82e-148 SMART
low complexity region 641 652 N/A INTRINSIC
low complexity region 671 684 N/A INTRINSIC
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Smo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Smo APN 6 29758894 nonsense probably null
IGL01969:Smo APN 6 29755172 critical splice acceptor site probably null
IGL02078:Smo APN 6 29754708 missense possibly damaging 0.46
IGL02248:Smo APN 6 29757292 missense possibly damaging 0.69
IGL02496:Smo APN 6 29758481 missense probably damaging 0.99
IGL03159:Smo APN 6 29758505 missense probably benign 0.00
knobby UTSW 6 29736174 missense probably benign
R0548:Smo UTSW 6 29759586 missense possibly damaging 0.45
R0606:Smo UTSW 6 29753604 missense possibly damaging 0.69
R1164:Smo UTSW 6 29754719 missense probably benign 0.18
R1438:Smo UTSW 6 29755483 missense possibly damaging 0.89
R1900:Smo UTSW 6 29736056 missense unknown
R2022:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2023:Smo UTSW 6 29754716 missense possibly damaging 0.87
R4033:Smo UTSW 6 29759918 missense probably damaging 0.98
R4795:Smo UTSW 6 29755574 missense probably damaging 0.99
R4878:Smo UTSW 6 29753571 missense probably benign 0.02
R4920:Smo UTSW 6 29759594 missense probably damaging 1.00
R5165:Smo UTSW 6 29736078 missense unknown
R5350:Smo UTSW 6 29754467 missense probably benign 0.02
R5554:Smo UTSW 6 29736124 missense possibly damaging 0.72
R6409:Smo UTSW 6 29736114 missense unknown
R6440:Smo UTSW 6 29756814 missense possibly damaging 0.93
R6707:Smo UTSW 6 29736174 missense probably benign
R6766:Smo UTSW 6 29736045 missense unknown
R7061:Smo UTSW 6 29760230 missense probably damaging 1.00
R7147:Smo UTSW 6 29758449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTGGAGGATGCAGTTTCTGACC -3'
(R):5'- CAGACATGTGGAGTTGAACAGC -3'

Sequencing Primer
(F):5'- GATGCAGTTTCTGACCTGAGCC -3'
(R):5'- GTTGAACAGCAATGTAGAAGCTATTC -3'
Posted On2014-09-17