Incidental Mutation 'R2129:Gm5581'
ID227833
Institutional Source Beutler Lab
Gene Symbol Gm5581
Ensembl Gene ENSMUSG00000061969
Gene Namepredicted gene 5581
Synonyms
MMRRC Submission 040132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131166365-131182379 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to C at 131168284 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072940
SMART Domains Protein: ENSMUSP00000072710
Gene: ENSMUSG00000061969

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 285 302 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
PDB:1MEY|G 422 507 4e-15 PDB
Blast:HNHc 445 504 4e-6 BLAST
ZnF_C2H2 509 531 9.73e-4 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 1.98e-4 SMART
ZnF_C2H2 593 615 1.52e-5 SMART
ZnF_C2H2 621 643 9.73e-4 SMART
ZnF_C2H2 649 671 9.36e-6 SMART
ZnF_C2H2 677 699 3.49e-5 SMART
ZnF_C2H2 705 727 9.88e-5 SMART
ZnF_C2H2 733 755 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204992
Meta Mutation Damage Score 0.6332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Gm5581
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Gm5581 APN 6 131167641 unclassified noncoding transcript
IGL01372:Gm5581 APN 6 131168403 exon noncoding transcript
IGL01630:Gm5581 APN 6 131168296 exon noncoding transcript
IGL01667:Gm5581 APN 6 131167772 unclassified noncoding transcript
IGL02260:Gm5581 APN 6 131167946 unclassified noncoding transcript
IGL03212:Gm5581 APN 6 131181450 exon noncoding transcript
IGL03306:Gm5581 APN 6 131168081 unclassified noncoding transcript
R0366:Gm5581 UTSW 6 131166447 unclassified noncoding transcript
R1764:Gm5581 UTSW 6 131181399 exon noncoding transcript
R1961:Gm5581 UTSW 6 131168162 unclassified noncoding transcript
R3177:Gm5581 UTSW 6 131166965 unclassified noncoding transcript
R4026:Gm5581 UTSW 6 131167068 unclassified noncoding transcript
R4289:Gm5581 UTSW 6 131167556 unclassified noncoding transcript
R4943:Gm5581 UTSW 6 131167125 unclassified noncoding transcript
R4961:Gm5581 UTSW 6 131167227 unclassified noncoding transcript
R5817:Gm5581 UTSW 6 131167169 unclassified noncoding transcript
R5944:Gm5581 UTSW 6 131168400 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAGCACTGAAGCACTGTTTAATCTC -3'
(R):5'- CACATTGGTGCTGTTTCATGC -3'

Sequencing Primer
(F):5'- CAAATGTCACTTTTTAATGTTTGTGC -3'
(R):5'- ACATTGGTGCTGTTTCATGCATTATG -3'
Posted On2014-09-17