Incidental Mutation 'R2129:Utp20'
ID227859
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 040132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88814055 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 431 (F431S)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: F431S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: F431S

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGATCGATCCAATCATCATTTTGG -3'
(R):5'- TGGCTGGCCATATTGTCTCC -3'

Sequencing Primer
(F):5'- CCAATCATCATTTTGGGTAGTATGC -3'
(R):5'- CTCCATGGAGAACTTCAATGCTG -3'
Posted On2014-09-17