Incidental Mutation 'R2130:Prelp'
ID227901
Institutional Source Beutler Lab
Gene Symbol Prelp
Ensembl Gene ENSMUSG00000041577
Gene Nameproline arginine-rich end leucine-rich repeat
Synonyms7330409J17Rik, SLRR2A
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133910304-133921414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133915131 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 92 (R92K)
Ref Sequence ENSEMBL: ENSMUSP00000048803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048432]
Predicted Effect probably benign
Transcript: ENSMUST00000048432
AA Change: R92K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048803
Gene: ENSMUSG00000041577
AA Change: R92K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 63 N/A INTRINSIC
LRRNT 68 102 5.86e-11 SMART
LRR 98 120 3.27e1 SMART
LRR 122 144 1.37e2 SMART
LRR 145 168 2.14e0 SMART
LRR 169 189 4.97e0 SMART
LRR 190 215 2.47e1 SMART
LRR 216 239 9.75e0 SMART
LRR 241 260 2.15e2 SMART
LRR 286 309 1.53e1 SMART
Blast:LRR 345 369 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160564
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine-rich repeat protein present in connective tissue extracellular matrix. This protein functions as a molecule anchoring basement membranes to the underlying connective tissue. This protein has been shown to bind type I collagen to basement membranes and type II collagen to cartilage. It also binds the basement membrane heparan sulfate proteoglycan perlecan. This protein is suggested to be involved in the pathogenesis of Hutchinson-Gilford progeria (HGP), which is reported to lack the binding of collagen in basement membranes and cartilage. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Prelp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prelp APN 1 133914807 missense probably benign 0.03
IGL02869:Prelp APN 1 133915267 nonsense probably null
R0972:Prelp UTSW 1 133914676 missense probably damaging 0.99
R1728:Prelp UTSW 1 133915131 missense probably benign
R1729:Prelp UTSW 1 133915131 missense probably benign
R1730:Prelp UTSW 1 133915131 missense probably benign
R1739:Prelp UTSW 1 133915131 missense probably benign
R1762:Prelp UTSW 1 133915131 missense probably benign
R1783:Prelp UTSW 1 133915131 missense probably benign
R1784:Prelp UTSW 1 133915131 missense probably benign
R1785:Prelp UTSW 1 133915131 missense probably benign
R1843:Prelp UTSW 1 133914757 missense probably damaging 0.99
R2049:Prelp UTSW 1 133915131 missense probably benign
R2131:Prelp UTSW 1 133915131 missense probably benign
R2133:Prelp UTSW 1 133915131 missense probably benign
R2141:Prelp UTSW 1 133915131 missense probably benign
R2142:Prelp UTSW 1 133915131 missense probably benign
R4694:Prelp UTSW 1 133914747 missense probably damaging 0.96
R6398:Prelp UTSW 1 133914741 missense probably damaging 1.00
R6415:Prelp UTSW 1 133912778 missense probably benign 0.38
R6415:Prelp UTSW 1 133914657 missense probably damaging 1.00
R6678:Prelp UTSW 1 133914775 missense probably benign 0.00
R6767:Prelp UTSW 1 133912710 missense probably benign 0.02
X0066:Prelp UTSW 1 133915276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGATGGCACCTCTTC -3'
(R):5'- CTGGGATTAGGCGTAAACCC -3'

Sequencing Primer
(F):5'- CTTCTCCATGTAGAGGAATGCCAG -3'
(R):5'- GGATTAGGCGTAAACCCAAGCC -3'
Posted On2014-09-17