Incidental Mutation 'R2130:Dbt'
ID227925
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Namedihydrolipoamide branched chain transacylase E2
SynonymsD3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116513070-116549981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116539124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 16 (D16E)
Ref Sequence ENSEMBL: ENSMUSP00000143696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349] [ENSMUST00000197201] [ENSMUST00000199614]
Predicted Effect probably damaging
Transcript: ENSMUST00000000349
AA Change: D197E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: D197E

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196376
Predicted Effect probably damaging
Transcript: ENSMUST00000197201
AA Change: D16E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000199614
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116539281 missense probably benign
IGL00660:Dbt APN 3 116546295 missense probably damaging 1.00
IGL00839:Dbt APN 3 116546114 missense probably benign 0.21
IGL00840:Dbt APN 3 116546114 missense probably benign 0.21
IGL00841:Dbt APN 3 116546114 missense probably benign 0.21
IGL00852:Dbt APN 3 116546114 missense probably benign 0.21
IGL00861:Dbt APN 3 116546114 missense probably benign 0.21
IGL00955:Dbt APN 3 116546114 missense probably benign 0.21
IGL00956:Dbt APN 3 116546114 missense probably benign 0.21
IGL01475:Dbt APN 3 116520259 missense possibly damaging 0.92
IGL01521:Dbt APN 3 116533383 missense probably benign 0.00
IGL01806:Dbt APN 3 116533305 missense probably damaging 1.00
IGL03288:Dbt APN 3 116548198 makesense probably null
R0025:Dbt UTSW 3 116534783 missense probably benign 0.22
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0190:Dbt UTSW 3 116539087 critical splice acceptor site probably null
R1650:Dbt UTSW 3 116534732 splice site probably null
R1750:Dbt UTSW 3 116546294 missense probably benign 0.18
R2131:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2133:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2897:Dbt UTSW 3 116523412 missense probably damaging 1.00
R3442:Dbt UTSW 3 116548191 missense probably benign
R4241:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4681:Dbt UTSW 3 116533314 missense probably damaging 1.00
R4724:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4736:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4737:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4738:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4740:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4809:Dbt UTSW 3 116546343 missense probably damaging 1.00
R4823:Dbt UTSW 3 116523387 missense probably damaging 1.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R5148:Dbt UTSW 3 116528244 intron probably benign
R5327:Dbt UTSW 3 116528571 intron probably benign
R5700:Dbt UTSW 3 116520303 missense probably damaging 0.97
R5931:Dbt UTSW 3 116523425 missense possibly damaging 0.80
R6463:Dbt UTSW 3 116539760 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTGCAGGGCTACTCTTATT -3'
(R):5'- CACTGGCTCTGTTCGGTCTT -3'

Sequencing Primer
(F):5'- TGGCTGGCCTGGAACTCAG -3'
(R):5'- CGGTCTTTGCCTGTGAACACTG -3'
Posted On2014-09-17