Incidental Mutation 'R2130:Crocc'
ID227933
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 040133-MU
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141029102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1071 (I1071V)
Ref Sequence ENSEMBL: ENSMUSP00000126543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000168157]
Predicted Effect probably benign
Transcript: ENSMUST00000040222
AA Change: I1071V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: I1071V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097816
AA Change: I1071V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: I1071V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102491
AA Change: I1235V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: I1235V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect probably benign
Transcript: ENSMUST00000168157
AA Change: I1071V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: I1071V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1561:Crocc UTSW 4 141030268 missense probably damaging 1.00
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R1935:Crocc UTSW 4 141034058 missense possibly damaging 0.78
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4591:Crocc UTSW 4 141018672 missense probably damaging 1.00
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R4992:Crocc UTSW 4 141046666 missense probably damaging 0.98
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5795:Crocc UTSW 4 141041807 frame shift probably null
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6060:Crocc UTSW 4 141036718 missense possibly damaging 0.92
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GGGCCAAGGTTCAGTTAGAG -3'
(R):5'- TTTTCTGGACGCACAGGCAG -3'

Sequencing Primer
(F):5'- TCTACCTGTGGGTCACAAAC -3'
(R):5'- AGGACTCAGCTGCGTGTG -3'
Posted On2014-09-17