Incidental Mutation 'R2130:Golga3'
ID227935
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 110202939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect probably null
Transcript: ENSMUST00000031477
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112512
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATTCACTTCTTGCAGAATGAG -3'
(R):5'- AGACACTCTTCCACAGCAGTG -3'

Sequencing Primer
(F):5'- CTTGCAGAATGAGAAGATTGTCTTG -3'
(R):5'- TCCGCAGATCACTCACAT -3'
Posted On2014-09-17