Incidental Mutation 'R2130:Mki67'
ID227955
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 135704241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably null
Transcript: ENSMUST00000033310
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211437
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGACTACCGGCCTTCTTG -3'
(R):5'- ACTTGGCGTGAAACAAACAC -3'

Sequencing Primer
(F):5'- GACTACCGGCCTTCTTGTAAATGTG -3'
(R):5'- TTGGCGTGAAACAAACACAAACG -3'
Posted On2014-09-17