Incidental Mutation 'R0152:Wdcp'
ID22796
Institutional Source Beutler Lab
Gene Symbol Wdcp
Ensembl Gene ENSMUSG00000051721
Gene NameWD repeat and coiled coil containing
SynonymsBC068281
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location4843303-4860043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4851583 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 480 (S480G)
Ref Sequence ENSEMBL: ENSMUSP00000151585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053034] [ENSMUST00000085793] [ENSMUST00000220170] [ENSMUST00000220215] [ENSMUST00000223551]
Predicted Effect probably benign
Transcript: ENSMUST00000053034
AA Change: S480G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054102
Gene: ENSMUSG00000051721
AA Change: S480G

DomainStartEndE-ValueType
Pfam:DUF4613 2 610 1.9e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085793
AA Change: S480G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082948
Gene: ENSMUSG00000051721
AA Change: S480G

DomainStartEndE-ValueType
Pfam:DUF4613 2 643 2.4e-280 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219069
Predicted Effect probably benign
Transcript: ENSMUST00000220170
AA Change: S480G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000220215
AA Change: S480G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000223551
AA Change: S480G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Wdcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL00774:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL02327:Wdcp APN 12 4851115 missense possibly damaging 0.95
IGL02725:Wdcp APN 12 4851206 missense probably damaging 1.00
IGL03377:Wdcp APN 12 4850691 nonsense probably null
IGL03381:Wdcp APN 12 4851926 missense probably damaging 1.00
R0317:Wdcp UTSW 12 4851583 missense probably benign 0.06
R1077:Wdcp UTSW 12 4850685 missense probably damaging 1.00
R1136:Wdcp UTSW 12 4851655 missense possibly damaging 0.78
R1571:Wdcp UTSW 12 4851924 nonsense probably null
R1653:Wdcp UTSW 12 4851815 missense probably damaging 1.00
R1848:Wdcp UTSW 12 4850245 missense possibly damaging 0.86
R4091:Wdcp UTSW 12 4855279 missense probably null 0.00
R5126:Wdcp UTSW 12 4850617 missense probably damaging 0.98
R6148:Wdcp UTSW 12 4850621 missense possibly damaging 0.74
R6529:Wdcp UTSW 12 4851143 missense probably damaging 1.00
R6800:Wdcp UTSW 12 4851358 missense probably damaging 1.00
U24488:Wdcp UTSW 12 4850405 missense probably damaging 1.00
X0026:Wdcp UTSW 12 4851077 nonsense probably null
Z1088:Wdcp UTSW 12 4850825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACATCTGCTGAGAGTCAGGG -3'
(R):5'- CAGAAAGATACTGCTGCATCGCAAC -3'

Sequencing Primer
(F):5'- GGCGCTTACTCCGACTTC -3'
(R):5'- TCGAGAGAGGATTTCCAGCTC -3'
Posted On2013-04-16