Incidental Mutation 'R2130:Myo15b'
ID227979
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115871643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1229 (V1229I)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
Predicted Effect probably benign
Transcript: ENSMUST00000093911
AA Change: V1229I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: V1229I

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.13
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATTGGCCTCTCGATTCCAG -3'
(R):5'- GCCTATGATCTCCAGGATGC -3'

Sequencing Primer
(F):5'- TCGATTCCAGCAGACCCTG -3'
(R):5'- TATGATCTCCAGGATGCCAGCC -3'
Posted On2014-09-17